• Log InLog In
  • Register
Liquid`
Team Liquid Liquipedia
EDT 08:00
CEST 14:00
KST 21:00
  • Home
  • Forum
  • Calendar
  • Streams
  • Liquipedia
  • Features
  • Store
  • EPT
  • TL+
  • StarCraft 2
  • Brood War
  • Smash
  • Heroes
  • Counter-Strike
  • Overwatch
  • Liquibet
  • Fantasy StarCraft
  • TLPD
  • StarCraft 2
  • Brood War
  • Blogs
Forum Sidebar
Events/Features
News
Featured News
[ASL21] Ro16 Preview Pt2: All Star5Team Liquid Map Contest #22 - The Finalists14[ASL21] Ro16 Preview Pt1: Fresh Flow9[ASL21] Ro24 Preview Pt2: News Flash10[ASL21] Ro24 Preview Pt1: New Chaos0
Community News
2026 GSL Season 1 Qualifiers11Maestros of the Game 2 announced42026 GSL Tour plans announced14Weekly Cups (April 6-12): herO doubles, "Villains" prevail1MaNa leaves Team Liquid22
StarCraft 2
General
Maestros of the Game 2 announced 2026 GSL Tour plans announced Blizzard Classic Cup @ BlizzCon 2026 - $100k prize pool MaNa leaves Team Liquid Team Liquid Map Contest #22 - The Finalists
Tourneys
RSL Revival: Season 5 - Qualifiers and Main Event Sparkling Tuna Cup - Weekly Open Tournament GSL CK: More events planned pending crowdfunding 2026 GSL Season 1 Qualifiers Master Swan Open (Global Bronze-Master 2)
Strategy
Custom Maps
[D]RTS in all its shapes and glory <3 [A] Nemrods 1/4 players [M] (2) Frigid Storage
External Content
Mutation # 522 Flip My Base The PondCast: SC2 News & Results Mutation # 521 Memorable Boss Mutation # 520 Moving Fees
Brood War
General
ASL21 Strategy, Pimpest Plays Discussions Data needed BGH Auto Balance -> http://bghmmr.eu/ [ASL21] Ro16 Preview Pt2: All Star RepMastered™: replay sharing and analyzer site
Tourneys
[ASL21] Ro16 Group C Escore Tournament StarCraft Season 2 [Megathread] Daily Proleagues [ASL21] Ro16 Group A
Strategy
Simple Questions, Simple Answers What's the deal with APM & what's its true value Any training maps people recommend? Fighting Spirit mining rates
Other Games
General Games
Nintendo Switch Thread General RTS Discussion Thread Battle Aces/David Kim RTS Megathread Stormgate/Frost Giant Megathread Starcraft Tabletop Miniature Game
Dota 2
The Story of Wings Gaming
League of Legends
G2 just beat GenG in First stand
Heroes of the Storm
Simple Questions, Simple Answers Heroes of the Storm 2.0
Hearthstone
Deck construction bug Heroes of StarCraft mini-set
TL Mafia
Vanilla Mini Mafia Mafia Game Mode Feedback/Ideas TL Mafia Community Thread Five o'clock TL Mafia
Community
General
Things Aren’t Peaceful in Palestine US Politics Mega-thread Russo-Ukrainian War Thread YouTube Thread Canadian Politics Mega-thread
Fan Clubs
The IdrA Fan Club
Media & Entertainment
[Manga] One Piece Anime Discussion Thread [Req][Books] Good Fantasy/SciFi books Movie Discussion!
Sports
McBoner: A hockey love story 2024 - 2026 Football Thread Formula 1 Discussion Cricket [SPORT]
World Cup 2022
Tech Support
[G] How to Block Livestream Ads
TL Community
The Automated Ban List
Blogs
Reappraising The Situation T…
TrAiDoS
lurker extra damage testi…
StaticNine
Broowar part 2
qwaykee
Funny Nicknames
LUCKY_NOOB
Iranian anarchists: organize…
XenOsky
ASL S21 English Commentary…
namkraft
Customize Sidebar...

Website Feedback

Closed Threads



Active: 2411 users

Avilo Fan Club

Forum Index > Fan Clubs
Post a Reply
Normal
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2015-01-30 05:42:18
April 06 2012 20:35 GMT
#1
[image loading]
Artwork by Kalfos.

Note: if you would like to be added to the fanclub, PM me or post in this thread indicating you would like to join, and I'll add you asap.

Important Vods + Show Spoiler +
22 July 2014 - avilo REKTS a Protoss deathball with Mech, such beauty, much art, so wow

16 July 2014 - Avilo's epic 3 hour game vs Patton in WCS NA Qualifiers Round 2

10 July 2014 -- Avilo Appears on the "Unfiltered" Show Alongside TotalBiscuit+ Show Spoiler +
Part 1:


Part2:


40 Motherfucking Nukes+ Show Spoiler +


Avilo Mechs it Happen vs Progamer Ax.Ryung

Avilo Mechs it Happen vs IMNestea

Avilo Mechs it Happen vs EG.Demuslim

Avilo Mechs it Happen vs EG.Idra Round 2

Avilo Mechs it Happen vs EG.Idra



Avilo Too OP for Livestream Chats + Show Spoiler +
[image loading][image loading]

We've been receiving reports here at Avilonation of an increasing number of livestreams that BAN users who mention Avilo's name in chat. Apparently, You-Know-Who's name is just too powerful for these livestreams to handle, so they've decided to censor it. Below is a list of all the livestreams that we've seen do this, with screenshots for proof. If you get purged, timed out, or banned for discussing He-Who-Must-Not-Be-Named in chat, please post about it in in this thread, preferably including a screenshot in your post, and I'll add the stream to this section of the fanclub.

Redbullesports + Show Spoiler +
Not only do viewers who mention Avilo get timed out (sometimes for over 86,000 seconds+ Show Spoiler +
[image loading]
), but AVILO HIMSELF has been perma-banned from the redbullsports stream. + Show Spoiler +
[image loading]


And of course anyone who even mentions Avilo will get timed out from chat...
+ Show Spoiler +
[image loading]


...unless they say something insulting about Avilo + Show Spoiler +
[image loading]


WCS America + Show Spoiler +
[image loading]
The left screenshot shows that the chatter was, in fact, timed out, while the right screenshot shows chat after I clicked on the now-clickable <message deleted> tag to reveal what they said.
Here's another image:
[image loading]

Most of the buzz about He-Who-Must-Not-Be-Named in the WCS chat was caused by his newest employee, TotalBiscuit, who ran a PRO-BONO advertising campaign for You-Know-Who in the WCS LR thread. TotalBiscuit's campaign was so successful that it managed to derail the LR thread for ten pages, causing You-Know-Who to give TB the Employee of the Year award.


Winter Starcraft (twitch name zlfreebird) + Show Spoiler +
[image loading]

Here's a close-up view of the text-in-question:
[image loading]

Why does Winter censor his name in his chat? Is he jealous of You-Know-Who? A couple viewers who frequent his stream claim that Winter is not jealous; he's simply trying to maintain order in his chat room because the mere mention of He-Who-Must-Not-Be-Named incites flamewars among his viewers. However, I'm not so sure. Awhile back, you see, I was reading a thread on the BNet forums, when I happened to come across several posts from, guess who:
[image loading]

[image loading]

[image loading]

Well he sure seems happy at the thought of Blizzard plotting against You-Know-Who with their balance patches. Seems Winter's a little resentful of You-Know-Who after all!


HTOMario + Show Spoiler +
This little gem was linked in Avilo's chat by a viewer ages ago. Finally got around to putting it in the fanclub.

[image loading]


GSL + Show Spoiler +
The GSL stream seems to have a bot set to auto-timeout anyone who says Avilo or various Avilo-related phrases (such as "brovilos" and "avibros"). GSL takes it one step further and auto-timeouts anyone who uses Avilo's subscriber-only emoticons (most streams allow his sub-only emoticons).
[image loading]


You KNOW you're successful when other streamers start seeing the green-eyed zerg monster.
And there you have it Brovilos (and Avibros), He-Who-Must-Not-Be-Named has now officially become a well-known figure in the SC2 esports community.



Avilo's Guides + Show Spoiler +
Rules of Mech -- A summary of the basic rules for playing mech as a Terran. Includes tips on when to attack, how to use each units, when to trade army units, etc. Highly-recommended.

[G] Avilo's TvZ Lategame Raven Transition

[G] Avilo's HOTS Bio Into Raven Accumulation Style

A Quick Reminder not to use BCs: + Show Spoiler +
[image loading]



Avilo's TL Moderation History #AviloFighting + Show Spoiler +
Avilo is not afraid to stand up and say what needs to be said. Many high-level players avoid making comments about balance because of the tendency the community has to flame players for making such comments. Avilo doesn't give a fuck about flames. Hateful comments bounce right off his thick skin. If he sees a problem, he'll stand right up and say it. Sometimes he gets in trouble for what he says. Below you'll find a list of all the times Avilo has made sacrifices in order to save e-sports.

On June 01 2013 02:21 avilo wrote:
When asking if something like this is viable you have to ask, "will it get through planetary nexus?"

If the answer is no, then no, it's not viable. There is a balance issue with the match-up right now involving the mocore/planetary nexus, but that's a topic for another thread

User was temp banned for this post and large assortment of past balance whine history/warnings/bannings.
Original Post ABL Entry

On March 01 2013 19:27 avilo wrote:
Terrible last two games. Roach all-in (which isn't even all-in you can just power drones behind it, Zero risk, all reward), and then a ling bane all-in ends the next game in 5 min...

Here's hoping to Taeja comes back next 3 games. Everyone should be glad that Zergcraft2 is coming to an end with HOTS soon.

+ Show Spoiler +

After the last two games, I leave the wisdom of Dkim here:
Now that the highest skilled pro players have been playing the beta for a few weeks, we've been gathering pro level ladder data, pro feedback, as well as watching all the HotS tournaments/show matches that have been going on.

Out of everything we're seeing and hearing from pro players, we think the most important issue we need to deal with rather quickly is early game ZvT.


The biggest issue in the ZvT early game at the highest pro level seems to be the mass Hellion contain leading into the various potential mass Hellbat combinations right when the Armory comes into play. The time between Terran gaining full map control and then converting all their map control units into straight up power units looks to be too narrow.

Even without this threat, Terran has plenty of early game strategies to utilize vs. Zerg. We're most likely going to add the Hellion to Hellbat transformation upgrade back to the Factory Tech lab with an Armory requirement. This will give Zerg more time to scout and prep against possible Hellbat based attacks when they see lots of Hellions in play.

Early game threats/aggression/all-ins vs Zerg are a "problem." All threats/aggression/all-ins vs Terran are perfectly fine and deemed as "good plays" though


User was temp banned for this post.
Original Post ABL Entry

On March 10 2012 22:17 avilo wrote:
Recap: Puma ahead in upgrades, ahead in army supply, ahead with third base. Lots of damage done to MC early game...also Puma holds off blink stalker all-in...MC hits 1 storm to win game, also is able to hit 2/2 b4 Terran's 1/1 is even finished and then hits 3/3 while Terran stuck on 2/2 due to chrono boost + cheaper upgrades.

Congrats MC... ....


User was temp banned for this post.
Original Post ABL Entry

On February 08 2012 21:13 avilo wrote:
Show nested quote +
On February 08 2012 21:11 Destructicon wrote:
While I hate to say this, Jakji lost himself that game. After he destroyed the big Toss army he should immediately have gone to deny Parting's 4th and/or secure his 4th and 5th. He didn't do either properly, allowed Parting too much leeway to build back up, and in the end he payed the price for it.


You would think after you kill 100% of your opponent's entire army after they make a huge mistake...with nearly 80% of your army leftover...you would think that you can win the game at that point...but you can't...that's TvP for you in the current state of the game.

Great play by parting...but if people still do not see there is a huge problem here...it's a bit crazy.

User was temp banned for this post.
Original Post ABL Entry

On January 24 2011 01:01 avilo wrote:
Well, I think this is a fairly justified rage blog luckyfool i'll help ya out with some rage

For people not high up on the ladder, or that just watch random games/replays, you have not seen the ridiculous bullshit on ladder in tvp. Literally any build you do in TvP, protoss has either a unit advantage, or economic advantage, where if you do not defend their bullshit, you lose the game, but if you do, they are still very much in the game with their expansion now up lol.

And like lucky raged bout, if you try aggression, they lol-field their ramp, and stop it and are ahead. Anytime protoss goes collosus, you absolutely have to always have 4-20 vikings, depending on their collosus numbers.

If you mis judge viking/marine/marauder ratio to his collosus/gateway/zealot/stalker numbers, you lose the game from not being able to stop collosus. Also, drops are a joke. Vs mediocre protoss, you will be able to tug them left and right with drops yes...but versus the higher up protoss, they simply will turtle and expand again. You invested into drops -> they do zero and protoss is still ahead now with collosus building up or switch to templar.

If you do not scout the timing on their templar you automatically lose the game from having no pre-emptive ghosts, which you must also perfectly EMP onto templar or you also lose ur entire bio army to the collosous + templars.s

Oh, and like luckyfool said, you can be a 30 apm noob and if you know the 4gate build order you can still win tournaments vs superior players - you can even win TLopens and lots of beta tournaments when everyone are noobies at the game *cough*

Also, a lot of the forum warriors have not seen the pure turtle templar/carrier style that some P sometimes do on ladder, with mass cannons. It sounds like a "lol that will never work" theorycraft, but there's a bunch of top protoss players that literally do that shit - cannon until they have khadayrin an then go carriers.

TvZ is even easier than TvP now imo. I'm not *whining* i'm just providing some anecdotal evidence to support luckyfool's rage - it's pretty justified. And also frustrating when you see certain players 4gate their way to sponsorships...

lol.

And on top of all this, scouting is insanely difficult to do in SC2. Lots of games can be coinflippy =/ ofc Zergs have more of a right to rage than we do as Terrans tho lol.

imo lucky, for tvp now, you have to literally build 3-5 bunkers at your natural to be safe - if you're doing some FE that is. Just play extremely safe on ladder, and build more bunkers than you need at your natural so shitty players don't just rush in and bust you.

And even then, yeah, the actual good protosses have an economic advantage and army advantage because you have to build the bunkers...but that's just the way the game is right now lol.



User was temp banned for this post.
Original Post ABL Entry

On December 15 2010 05:02 avilo wrote:
Show nested quote +
On December 15 2010 04:39 SjoW wrote:
On December 15 2010 04:33 ribboo wrote:
On December 15 2010 03:52 SjoW wrote:
I dont feel like scouting with the early scvs since there is no real information to gain except proxygateway/6pool/proxy rax and all theese can be handled if played properly without using the first scv scout. Its usually all about telling your mind hes gonna cheese me 100% and its often easier to manage it and after that the game usually already have been decided right there after his failed attempt.

vs toss everything looks the same up until 4.5 - 5 min mark and thats when he get a stalker out to neglect any scouting scv. Same goes with zerg and terran they all block their ramp with zergling or marines when the you need the information.

And what about using scans? If you're a terran player you know how terrible this is, basicly its 270 down the drain and not even 100% sure to spot his tech path.

My first scout is always the first helion that comes out. And thats usually the time when you have to see what your opponent is doing. I also feel that people understimates the reads and information you can get just by seeing an opponents army composition early on. Just by poking up the ramp with the first helion gives me the information I need to set aside which openers hes not doing and what he can potentially do.

There's other ways to abuse a player that dont scout tho. 16 nexus / 16 cc but if you do the math they are almost equally strong to 1gw expo or 1rax orbital command expo. And theese openings I usually spot in time with my helion scout to be able to react properly. 1/1/1 is the most versitile build there is you get the option to go any route you want basicly.

Lately tho i've been struggling with 4warpgate / 3warpgate/voidray. And its usually because im playing poorly, But mostly its because players have adapted to my helion runby and starting blocking their ramp with units or pylons to see what they are doing in time.

Im still certain an 1/1/1 build can handle any cheese even without scouting it, if you play it perfect. And thats what im trying to achieve. If this isnt the case I will ofcourse change my gameplan and try to tap that leak.

My predictions for the future will be TvT (no scv scout) TvP (no scv scout) TvZ (I will scout an early scv)

What about mid/lategame scouting? I was watching your stream the other day, I'm not sure what tournament you were playing, you lost one match to a 2gate proxy though. (If that helps you remember)

Anyway, my general feeling was that you barely scouted mid/late game either. You might have gotten some scouting intel with your hellion, but that was the first and last time you got some intel from the opponents base. You didn't scout any expos, at any time. Don't you feel like this can be abused?


It was against slider I lost to 2 gw proxy, and after that game I ofcourse checked the replay and saw my mistake and started talking to merz how to deal with it, and we agreed upon scouting with marines outside your base is the most optimal play.

the helion scout sees if theres a expansion outside his base and i constantly patrol between xelnaga towers and opponents expasion/base to see exact timing of his expansion. If you mean hidden expansion, thats just putting yourself in real danger and I would be glad if someone tried something like that against me.


omg lol, you guys got together in a lil meeting and discussed how to stop that?
Did it go something like this?"

sjow: yo i just lost to proxy gates, there's probably some real real easy way to stop it that i just haven't thought about

merz: well...in brood war, we used to use those worker guys to scout around for a proxy...because it's possible an opponent could do that

sjow: i don't use scv to scout

merz: ...you said proxy2gate right?
sjow: yeah, that's what it was, there's gotta be some nice adaptation build i can do

merz: yeah...just scout for the proxy
sjow; you mean with like a marine?

merz: no, with an scv.
sjow: how do i do that?

User was temp banned for this post.
Original Post ABL Entry

On October 12 2010 02:46 avilo wrote:
Show nested quote +
On October 12 2010 02:44 GoldenH wrote:
I live in the fantasy world where I am a 1400 diamond protoss player who regularly employs void rays as harassment against terran and know what army i can attack and win and what will soundly defeat me.

If you throw down 2 or 3 rax anytime after the five minute point you will easily have enough army to hold it off by the time 3 void rays are out.


.....you don't know what the fuck you're talking about.

User was temp banned for this post.
Original Post ABL Entry

On May 12 2010 11:20 avilo wrote:
regardless what blizz and browder bullshits to us, the sc1 high ground mechanic is 100x better than the trash they still have in this game. SC1's is just more depth. Period.

User Temp Banned for this post: Tone
Original Post ABL Entry



Avilo's chat EPICNESS! + Show Spoiler +
There are many great things about Avilo's stream; but one of the best ones has to be his stream chat. Avilo's chat is chock full of some downright AWESOME people who are chillax, laid back, funny, and just generally really fun to be around. He keeps his chat relaxed, but prevents it from being overrun by trolls. In this section of his fanclub, I will be documenting some of the awesomeness that goes down there. Enjoy!

PS I'll try to do a better job of keeping up with this than I have done with the whole "Phrase of the Day" thing.
7 July 2014 -- Funny parody thingy that a viewer cooked up
5:12 Jameslove4040: our avilo , who art in sc2. hallowed by Thy name, Thy sc2 come, Thy will be done on sc2 as it is in Heaven. Give us this day our daily win in sc2, and forgive us our loses as we forgive those toss an zerg win against us. And lead us not into temptation to be zerg or toss but deliver us from thr zergs and toss amen

9 November 2013 --- Funny comeback from a fan to a troll.
11:12 Derkhy: i really hate avilo
11:13 Sw4rmlord: @Derkhy its okay. He doesn't even know you exist.

8 October 2013 --- Proof that Arkansassy is blond.
+ Show Spoiler +
Mecto linked this: http://imgur.com/uWj9Pib

+ Show Spoiler +
12:34 Scar_ksm: sc3 will be released in 2040
12:35 Mod Arkansassy: what's sc3 called?
12:35 Pandagamer8: there is not gonna be a sc3 if the game dies
12:35 Scar_ksm: revengeof david kim
12:35 Avidwatcher88: starcraft 3...
12:35 Mod Arkansassy: lol Avidwatcher...thx


6 October 2013 --- Failtroll gets trolled.
+ Show Spoiler +
9:41 Jasonteoh: is avillo ***?
9:41 Mod Subscriber Codonbyte: yes, he is a triple star
9:41 Alberoto019: what does kappa mean???
9:41 Subscriber C8654b:
9:41 Restinpieced9: ***?
9:41 Subvertiox8: yes hes a star
9:41 Restinpieced9: what is ***?
9:41 Alberoto019: what is the significate of kappa?
9:41 Goldencoyote: means
9:41 Subscriber C8654b: *** = star
»
9:41 Noxtherox: it significates you're trolling
9:41 Mod Bahuntome28: *** = gosu
9:41 Adamzaman: jasonteoh fail troll
9:41 Mod Turbo Subscriber Christowolf: means silly
9:41 Restinpieced9: Avilo is a star, yes


5 October 2013 --- Protoss viewer had a good day on ladder.
+ Show Spoiler +
11:04 Rlrturkeydano: sup yall
» i had a fine day on the ladder
...
11:04 Rlrturkeydano: i stop cuz i dont wanna beat my buddy here
...
11:05 Subscriber Meldrath: A fine day on the ladder... obviously protoss
11:05 Loxinator2k12: LMAO
11:05 Subscriber Niwani: lol

[At this point, Avilo starts ranting about how protoss players everywhere always have a "fine day on ladder" and terrans only get a "fine day on ladder" when there are no protoss players]


11:05 Rlrturkeydano: haha
11:05 Subscriber F7supercereal: ^
11:05 Subscriber Gophar: hahahaha
11:05 Rlrturkeydano:
11:05 Subscriber Niwani: haha
11:05 Mindcontrol111: haha
11:05 Subscriber Tumesbot9000: lol
11:06 Mod Subscriber Codonbyte: tumesbot!!!
11:06 Littleredboy: Does protoss ever have a bad day on ladder?
11:06 Mod Subscriber Codonbyte: yes
11:06 Rlrturkeydano: yesss
11:06 Subscriber Gophar: rofl
11:06 Jfizzle145: lol
11:06 Mod Subscriber Codonbyte: sometimes they misclick the mothership core ability onto the assimilator instead
11:06 Subscriber Tumesbot9000: Codon!!!!!!!!!!!!!!!!
...
11:06 Goldencoyote: what a nice day you had
11:06 Owebe: easiest troll ever
11:06 Rlrturkeydano: i stop so to not make avilo's day worse


4 October 2013 --- Twitch's most excellent coding revealed Kappa.
+ Show Spoiler +
Sorry, we were unable to connect to chat. Reconnecting in 0 seconds.
Sorry, we were unable to connect to chat. Reconnecting in 0 seconds.
Sorry, we were unable to connect to chat. Reconnecting in 0 seconds.
Welcome to the chat room!


2 October 2013 --- Goldencoyote and Rexx977 speak the truth about Protoss.
+ Show Spoiler +
12:29 Goldencoyote: Beating a Protoss in lategame is better than sex, honestly
... ... ...
12:31 Goldencoyote: i get off at least twice after beating a protoss man
... ... ...
12:33 Goldencoyote: actually beating Protoss does take more afford than getting laid
... ... ...
12:35 Rexx977: got up to 125 in tvp as T..... lost to deathball and 47apm...


2 October 2013 --- Sazzypantz doubts I'll do a better job at keeping up with this game, and I prove her wrong by adding the exchange to "Avilo's Chat EPICNESS!". Take THAT sazzypantz!
+ Show Spoiler +
12:17 Mod Subscriber Codonbyte: I'll be adding to that regularly (hopefully more regularly than I add to Phrase of the Day)
12:17 Mod Arkansassy: they all told me it means sarcasm too Thyriaen
12:17 Dangrath: + =
12:17 Akusta: Oh god
12:17 Schu_22: lol wow
12:17 Milky_hate:
12:17 Arkansassy don't believe Codon...he disappears a lot
12:17 Subscriber Gngp: !
12:17 Mod Subscriber Codonbyte: hey, I've been getting better, haven't I?
12:18 Thyriaen: so when someone just comments something with only the word "kappa"
12:18 Steve518: Aww yeah. I love attention.
12:18 Mod Arkansassy: you're like avilo...you're better for a week then you fall off the edge and have to be kicked in the butt again
12:18 Thyriaen: then ? you cant really comment with just being sarcastic
» i dont get it
12:18 Mod Arkansassy: and did you get my PM, codon?


2 October 2013 --- Steve518 getting back from a timeout during Tuesday STREAM OF DEATH.
+ Show Spoiler +
12:03 Steve518: Turns out theres no mroe room in hell, so I'm back. Godfrog* gives his regards b t w.

*Godfrog is the biggest, baddest, cutest, sweetest, creepiest, most annoying troll to ever grace Avilo's stream chat. Click here to check out this post that he made, which should give you an idea of what he was like in-chat.
But that's not all [spoken in sing-song commercial voice]. Godfrog is also a stalker who spends his free time stalking people, and making violent threats against women who try to stand up to his amphibious wrath! When Avilo refused to make him mod and Arkansassy told him to stop asking, he sent her some pretty disturbing messages, and started stalking both her AND Avilo. To this day, his name is incredibly infamous in his chat. Indeed, most Avilo fans are too scared to even say the cursed name, for fear that it may be jinxed, and instead refer to him as "you-know-who", or "she-who-must-not-be-named" (yes, she, for Arkansassy decided that Godfrog was a little girl, and what sassy says is THUS).




Phrase of the Day + Show Spoiler +
28 August 2014 -- "Oh my god am I going to beat a fucking maphacker?!?" -Avilo played vs a maphacker (confirmed really obvious maphacker) who kept sniping him and he WON. Even though the guy was both maphacking and playing Protoss.
3 August 3014 -- "The sensor tower really is the best defensive structure in the game." -Proof that Avilo does not only complain about Terran being underpowered. EAT IT HATERZ!!!
28 July 2014 --- "Oh, it's Cheesy McCheeserson. He's going to go mass reapers because he doesn't know how to play a proper macro game against me. Although I guess most people don't know how to play a proper macro game against me."
21 October 2013 --- "These guys whine more than I ever whined."
10 October 2013 --- "That is some serious Martha Stewart action!"
---8 September 2013 -- "That muta harass hurt -- a tiny bit."
--- Avilo's comment after smashing some sad zerg :D

23 June 2013 -- (shouting at someone knocking at the door) "ONE MOMENT!!! [then mutters] in other words, fuck off!" --- Avilo's response to someone who doesn't know that you do NOT disturb someone during a ladder game.

14 June 2013 -- "I don't give out gg's like T-ball trophies!" --- Avilo's response to a viewer complaining that he didn't GG his opponent.

9 April 2013 -- "It's like chasing a piece of shit in a fucking circle!" --- Avilo describing what playing mech TvP is like.

23 March 2013 -- "Where's the twilight council, bitch? It's on the other side of the map, and it's a stargate! Oh, now it's a robo!" -Avilo commenting on how Protoss often hides buildings around the map in random locations.

10 December 2012 --- "Silly Terran, bio is for kids!!!"

18 September 2012 --- "We have problem vs BL/infestor ?! ... they give us firebats. What The Fuck."

15 September 2012 --- "This zerg is like those little kids in that diaper commercial where everyone is saying 'I'm a big kid now!'"
After a zerg player made nothing but roaches for the entire game (no infestors even, lol).

30 August 2012 --- "It takes a special kind of zerg to lose ZvT."
After a poorly-executed zerg all-in failed, Avilo typed the above in chat.

26 August 2012 --- "If there was a construction program on Aiur, and I signed up for it, they'd be all 'wtf man, why are there so many holes in this wall?' And I'd be all 'dude, I'm from planet earth! I just got here brah!'"

24 August 2012 --- [After killing his opponent's carriers while going Mech] "Well guys, about now he would remax on gateway units... except he doesn't have any gateways, because I NUKED THEM ALLLL WAAAAGGHHAAHAHAHAAA!!!"

22 August 2012 --- "I want a magic baseball bat [like zerg]. Why can't I just 5-rax reaper everyone again?"

21 August 2012 --- "[sounding worried] God, I hope he's not switching to BCs. For his sake, i mean."

18 June 2012 --- "...that one number, being tweaked in the note-pad file where they save the changes..." --- Avilo in his latest TvZ video (check it out HERE), talking about the +2 range buff to the queen.

18 June 2012 --- "If you wanna throw all the 'balance whine' stuff at me, fine. As long as we get the game fixed, I don't really care." --- While this quote isn't funny or ridiculous or random like some of the others, I think it highlights on of Avilo's better qualities: he's not afraid to share his honest opinion, even if he gets flamed for it. Many pro players wouldn't dare make comments about balance for fear of getting flamed. Not Avilo. He made this quote in this youtube video, which you can watch HERE.

13 June 2012 --- ...First of all, the map is insanely fucking huge. Second of all, the map is insanely fucking huge, and third of all, the third base is really... far, and the map is insanely fucking huge. --- Avilo expressing his love for the map Condemned Ridge.

13 June 2012 --- The official counter to bronze league is building a bajilion nuke silos. --- Avilo was playing a TvT when he realized that his opponent didn't have any idea how to play SC2 (they weren't bronze-level bad, but they were well below masters-level, which is what the account was rated). It will forever remain a mystery as to why their play was so far below masters-level. Maybe they were letting their little brother play or something, lol ^_^

6 June 2012 --- wtf, dude...you can't use the stuff I taught you against me!! --- When Avilo's first student almost beat him at a TvT.

6 June 2012 --- If you have two accounts, just get on the one that's ranked lower and you'll be sure to get some TvTs. --- At the start of a stream, he was explaining why he decided to play on his lower-ranked account.

13 June 2012 --- OMG he doesn't have infestors????? *Proceeds to cast 6 million seeker missiles and win game. --- TvZ when Avilo realized that enemy broodlords and corruptors had no infestor support and he had a bunch of ravens with energy for seeker missile. Guess what happened next?.

9 May 2012 --- My lead right now is 'ginormous as my penis. --- No explanation necessary XD

28 April 2012 --- 4 is my hotkey to remember what I need to remember. --- Avilo was messing around with his hotkeys on-stream, rebinding them in weird and awesome ways.

4 June 2012 --- Sorry, uh, my cat's on fire, and uh, I just stuck my dick in a lightbulb, so I can't off-race you atm. But trust me it's really easy! --- Avilo talking in funny voice after he challanged a Protoss player to off-race him after the Protoss player complained about Terran being OP.

3 June 2012 --- I'm not a terran player, I'm a bunker farmer. --- Avilo held off a Protoss all-in during the supposed "mig-game advantage" that Blizzard said Terran was supposed to have.

3 June 2012 --- AAAAAAAGHHHH FUCK YO BROODLORDS!!! --- Avilo shot some seeker missiles at some enemy broodlords and then ran away just in time to avoid fungals.

28 April 2012 --- God forbid he learn what infestors are. Then we really are in trouble." --- After a long and frusterating TvZ where Avilo lost a 200/200 army to Broodlords. I'm pretty sure he managed to win somehow despite that, though.

9 May 2012 --- "TvP really makes me wanna kill a goat!" --- After yet another one of those typical TvPs that makes Avilo's blood boil.

3 May 2012 --- "The thing is -- I need to lose SCVs right now, so this is sort-of actually good." --- TvP on a Protoss-favored map, and Protoss warped in some zealots into one of his mineral lines and they started slicing and dicing his SCVs. Instead of running his SCVs away, he had them fight back against the zealots lol.

3 May 2012 --- "I'd rather jack off a donkey while being fucked in the ass by a whale than play another TvP!" --- He chose random to let off some steam after a bad TvP. He got matched against a Protoss and rolled -- you guessed it --- TERRAN.

3 May 2012 --- 'When I have my creep spread at your third base by the 10 minute mark, then you can tell me it's meaningless." --- When Brinkersc said "it wont even effect anything quit crying. this upcoming patch is meaningless." in Avilo's stream chat, he responded with the above quote.

28 April 2012 --- I'm not just rebinding the physical keys. I'm rebinding my fucking brain. --- Avilo made a major overhaul on his hotkey setup today on his stream. He spent well over an hour remapping his hotkeys to optimize his apm efficiency. He even made Y and U control-group hotkeys!!

April 25 2012 --- "YES BECAUSE I HAVE 5000 APM AND YOU HAVE 20" --- It was another one of those long TvZs where zerg keeps makes broodlord infestor. Anyway, Avilo managed to win, and his opponent said "lol Terran, zerg actually has to rebuild bases", to which Avilo replied the above quote :D

April 23 2012 --- "Cheesy ladder fucks" --- After Avilo whupped some guy who built a hatchery in his (Avilo's!) base and then accused him of using a maphack when the hatchery was within vision range of Avilo's CC XD

April 23 2012 --- "Reaper INTO banshee?!?? Cool story bro" --- After some guy went reaper into cloaked banshees, and Avilo had 3 orbitals at his disposal for scans XD lololol



I started watching Avilo's stream in 2011, after finding out about him on Chickstv's stream. Avilo is a Grandmaster Terran playper on the NA server who's known for frequently going full mech in EVERY matchup. There are occasional exceptions, he does do other styles on certain maps that are particularly bad for mech, and sometimes he'll do bio in TvP, but mostly it's mech all the way!

He is also known for playing really long games. Indeed, 45 to 60 minutes is very common for him, and 90 minutes to 2+ hours is not unheard-of.

As the game passes the 1 hour mark, his vast excellent understanding of the late-late game timings and transitions becomes ever more apparent. During these long games, he'll frequently build large numbers of orbital commands to allow him to sack SCVs, and he'll do multi-pronged harrass with nukes to make his opponents tear their hair out (and then lose).

If you're tired of seeing hyper-aggressive Terran games that are over before the 20 minute mark, or would like to see something other than stutter step split 3-pronged marine drops, then this player is for you! So be sure to drop by his stream, which you can find HERE: www.twitch.tv/avilo

Updates log + Show Spoiler +

7 July 2014
  • Added screenshots of other streamers censoring Avilo's name in their chats, thus demonstrating Avilo's growing popularity and prominent position in the community.
  • Started noting updates to this section of his fanclub because I had been slacking on doing that lately, making it look like I haven't updated the fanclub since 2012 when in reality I have updated it several times in 2013.

24 June 2013
  • Added screenshots of Avilo spanking RatZDeezer on stream.

17 June 2013
  • Changed the intro text at the top of the fan-club.
  • Added a "How to Help Support Avilo" section, which includes tips on how to write an effective post in the Featured Streamer thread.
  • Fixed an embarrassing spelling error in the newly-added "How to Help Support Avilo" section

14 June 2013
  • Added a BUNCH of people to the fan club that really should have been added a LOOOONG time ago (sorry).
  • Removed an EXTREMELY outdated poll that should have been removed ages ago (sorry again).
  • Moved the News and Upcoming Events section up to the top, just below the main image of Avilo.
  • Added a note to News and Upcoming Events about Avilo's latest ban on TL.net.

10 December 2012
  • Added a new Phrase of the Day.

18 September 2012
  • Added a new Phrase of the Day.

16 September 2012
  • Added a new Phrase of the Day (an especially good one, too!!)

30 August 2012
  • Added a new Phrase of the Day.

27 August 2012
  • Added a link to Avilo's new Ghost Mech replay pack.

27 July 2012
  • Added a link to Avilo's post about a hidden ghost nerf in HotS.

18 June 2012
  • Added another quote to Phrase of the Day.
  • Added another link to a youtube video.
  • Added yet another quote to Phrase of the Day.

17 June 2012
  • Added FOUR quotes to Phrase of the Day :D
  • Added a link to Avilo's post about the new HotS units.

13 June 2012
  • Added another quote to Phrase of the Day <3 <3 <3

6 June 2012
  • Added THREE quotes to Phrase of the Day XD.

9 May 2012
  • Added another couple phrases to Phrase of the Day (hmmm... maybe I should start calling it "Phrase of the Every Other Day").

3 May 2012
  • Added THREE phrases to Phrase of the Day to make up for the fact that I've been slacking on it.

29 April 2012
  • Added a link in the Links section to a video of Avilo casting a game between liquidtaeja and complexitykiller for the IPL caster search.

28 April 2012
  • Added ANOTHER phrase to Phrase of the Day. Check it, yo!

25 April 2012
  • Added another phrase to the Phrase of the Day. CHECK IT OUT YO!!!

23 April 2012
  • Added a Phrase of the Day section. CHECK IT OUT :D
  • Added a second phrase to Phrase of the Day section because it was just too darn badass.

14 April 2012
  • Added a replay of Avilo playing a long game against Protoss with lots of buildings getting nuked!

11 April 2012
  • Added a replay of Avilo doing the super-duper-funtime-build against Protoss!! :D

10 April 2012
  • Added an AWESOME EPIC replay where Avilo NUKES BROODLORDS!!!! :D It's in the Links and Stuff section.

9 April 2012
  • Added a new profile picture.

8 April 2012
  • Added an updates log so that viewers can see the most recent changes.
  • Added a Profile Pictures section.
  • Added a links section.




Profile Pictures --- I will be periodically changing the image at the top of this post. This section contains all the images that may be used as the profile image at the top. If you have any suggestions for profile images, PM me or post a response.
+ Show Spoiler +
If you pause a replay when a launched nuke is at just the right altitude, you can get a VERY close-up view of the missile itself.
[image loading]

I TRIPLE DOG DARE you to make one more marauder!
[image loading]


EPIC EPIC SUPER NUCLEAR ATOMIC AVILO GAME PICTURES!!! + Show Spoiler +
One of the things Avilo is known for is his widespread use of nukes in his game play. He was the first player to figure out just how awesome nukes are, and he often makes extensive use of them late-game in all match-ups, both for harassment, and defensively, to force enemy armies to retreat.

What REALLY Caused the Fall of Aiur...
+ Show Spoiler +
[image loading]

[image loading]

[image loading]

[image loading]



Sometimes, that goddamn Protoss deathball just WILL NOT DIE. When that happens, Avilo is ready to bring out the big guns...
+ Show Spoiler +
[image loading]

With the center of the map locked down tight with PFs and defensive nukes, Avilo is ready to start battlecruiser production!
+ Show Spoiler +
[image loading]


EMPs reduce the number of feedbacks that Avilo's fleet will have to deal with.
+ Show Spoiler +

[image loading]


Protoss, in a last ditch attempt at survival, makes void rays and a mothership to deal with Avilo's death-fleet...
+ Show Spoiler +
...but that proves to be quite ineffective.
[image loading]



Avilo getting his macro on!
+ Show Spoiler +

Zerg players build macro hatcheries; Avilo builds macro orbital commands
[image loading]

Protoss not dead yet? Time to make CATTLEBRUISERS!!!!
[image loading]

I'm pretty sure this many nuke silos violates some sort of global peace treaty...
[image loading]


Want to see some epic Avilo games? Check out his Nuclear Replay Pack, which
he posted HERE: http://www.teamliquid.net/forum/viewmessage.php?topic_id=195223


Members + Show Spoiler +
1. Arkansassy
2. Codonbyte
3. Ewic
4. Chicks
5. OtoshimonoU
6. IMoperator
7. Bokacho
8. Gawdsed
9. OmegaKnetus
10. slytown
11. Bajsgrodan
12. xNomax
13. crocodile
14. banedroppa
15. Hollandrock
16. myriad110
17. BakedBeansYo
18. RamonMcGrady
19. CaptainCharisma
20. Fishes
21. AyaaLa
22. consonance
23. zmansman17
24. Psychobabas
25. Rick Deckard
26. NoPnuts4me
27. Ma
28. Ekhao
29. namu
30. Turr1can
31. PassionsC
32. ( bush
33. dakinaw
34. GodFrog
35. rom1
36. Strahl
37. Blargle
38. LgNTheoRy
39. acgFork
40. Kiri (xOKiri.248)
41. acgFork
42. Karmy.SC
43. humblecoder
44. dvorakftw
45. chambertin
46. Sc2Alucard
47. D0lph Lundgr3n
48. disciple1776
49. rockerfella99
50. b0ats
51. PuLsai
52. XERtirips
53. LicoriceCoke
54. steve518
55. Ralethon
56. vorxaw
57. StringentShivan
58. cjpsuave
59. Polar_Nada
60. DG.Zeya
61. HeroMystic
62. jazzhawg
63. Christolight
64. BarthVR
65. ScoobyBR
66. HeathenHill
67. benthekid
68. Ninjagoldfish
69. Irave
70. GreatFlukee
71. SMX995
72. Chickenzrage
73. bigtabs
74. Spikeke
75. 89733
76. Jockmcplop
77. bigtabs
78. SMX995
79. Kalfos
80. kotabear
81. Doodsmack
82. Wojciech Zywny
83. Bloudemane
84. cpuser999
85. Wafflelisk
86. Trumpetmcool
87. MajorTom89
88. Goutz
89. starslayer
90. JDfz
91. Slabocans
92. lamprey1
93. Weavel
94. Kevm3O
95. rel
96. mafaba
97. SYG
98. Painiyff
99. Kythol
100. OneBasePlay
101. VisionZ
102. ROOTCaliber
103. Drunkenboi
104. ToD
105. TT1
106. Gophar
107. bahunto28
108. isaachukfan
109. SnowAngel
110. Meldrath
111. ZaMa
112. inc595
113. NorthQuab
114. Neoghateron55
115. Aeligos
116. PaeZ
117. Klimax (twitch name: jamesklimas)
118. LordBishopX
119. Smokey_martini
120. ZaMa (AdamZaman
121. FLORIDACOMPACT
122. Insomniac313
123. Predominance (ShagrathIT)
124. HallofPain
125. GrundyKane
126. dosnetwork (twitch: Celeron)


News Archive --- Breaking news that's already been broken + Show Spoiler +
Avilo beats RatZDeezer on ladder!!!!! 23 June 2013 --- Deezer is up to his old tricks again, stream-cheating and BMing it as usual. But not even an effective maphack was enough for him to beat Avilo.
+ Show Spoiler +
[image loading]

[image loading]

Deezer denied watching Avilo's stream.
[image loading]

Whenever Avilo would suggest out loud that Deezer was watching his stream, Deezer would deny it!
[image loading]

He even responded to insults that Avilo said out-loud on his stream!
[image loading]

[image loading]

Headphone users who had their volume too high were very sorry indeed...
[image loading]

I'll be adding the replay if and when I can nag Avilo into putting it up.


1 July 2013 -- Avilo gets unbanned from TL.net. He was banned for telling it like it is in this post:
On June 01 2013 02:21 avilo wrote:
When asking if something like this is viable you have to ask, "will it get through planetary nexus?"

If the answer is no, then no, it's not viable. There is a balance issue with the match-up right now involving the mocore/planetary nexus, but that's a topic for another thread

User was temp banned for this post and large assortment of past balance whine history/warnings/bannings.

Way to go Avilo!! Tell it like it is!


ATTENTION HATERS: Taeja says what Avilo has been saying for the last couple years
Well haters, here it is -- Avilo is not the only one who believes that Protoss is broken as fuck. Here it is, folks: straight from the horse's mouth:

[image loading]

[image loading]
BREAKING NEWS *** BREAKING NEWS *** BREAKING NEWS *** BREAKING NEWS *** BREAKING NEWS

AVILO BEATS MINIGUN IN ZOTAC NA CUP USING MECH! THATS RIGHT FOLKS!! AVILO BEAT PROTOSS WITH MECH!!!!! AND THE PROTOSS WAS MINIGUN!! WHO'S ACTUALLY GOOD!!!! AND MINIGUN WENT CARRIERS!! HE WENT STRAIGHT TO CARRIERS!!!! YET SOMEHOW, AVILO MANAGED TO SPANK HIS BROKEN ASS!!!



**BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS**

OMG OMG OMG GUYS GUYS GUYS!!! LET IT BE KNOWN THAT AT ABOUT 7:50PM ON THE 31ST OF OCTOBER (HALLOWEEN) OF THE YEAR 2013, DAVID "AVILO" BLOWE DEMOLISHED INCONTROL USING MECH!!!!!!

In an epic game lasting over an hour, Avilo beat every vile protoss mech-killing thing: chargelots, blink stalkers, immortals, and finally a super-late-game protoss army of tempest HT and a few carriers! More details will be added shortly.

**BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** ** BREAKING NEWS** **BREAKING NEWS**
Okay, so I'm three days late on this, but better late than never! Anyway, here goes:

OMG OMG OMG OMG OMG YAAAAAAAAY HOLY SHIT SO GAIS GUESS WHAT GUESS WHAT GUESS WHAT??!!!?! AVILO STOMPED IDRA IN A SUPER-DUPER-PUPER LONG-ASS AVILO MECH GAME! THAT'S RIGHT, IDRA, WHO LOOKS DOWN ON AVILO, ALWAYS TRASH-TALKS HIM AND IS A BIG MEANY HAS BEEN STOMPED FLAT BY THE AWESOME POWER OF AVILO'S MECH ARMY!! CHECK OUT THE GAME!! HE HIGHLIGHTED THE TWITCH VIDEO OF THE MATCH, SO IT'S NOT GOING AWAY ANY TIME SOON!! GO AND CHECK IT OUT EVERYONE!!
CLICK HERE TO SEE AVILO STOMPING IDRA INTO AN EXTRA CRISPY ZERG-FLAVORED PANCAKE!


**BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS**
OMG OMG OMG YAAY HOLY SHIT GUYS GUYS GUYS ON THIS FINE EVENING ON THE 4TH DAY OF THE TENTH MONTH OF THE 2013TH YEAR AFTER THE START OF THE GREGORIAN CALENDER AVILO WAS FEATURED ON TEAMLIQUID OMG FINALLY YAAAY AFTER ALL THIS TIME HE WAS FEATURED! WE KNEW HE HAD IT IN HIM!! AND HE GOT FEATURED! PEOPLE ARE STARTING TO SEE ALL THE HATE FOR WHAT IT REALLY IS: JEALOUSY! AND RIGHTFUL JEALOUSY BECAUSE AVILO IS ONE TRIPPIN' DUDE OMG HE'S FEATURED YES YES YES YES YES YES AAAAAAAA IMA CELEBRATE BY EATING ALL KINDS OF SUGAR THAT WILL MAKE ME REALLY REALLY REALLY REALLY REALLY REALLY REALLY REALLY REALLY REALLY HYPER AAAAAAAAAAAAAAAAAAAAAAAA!!!
[image loading]
**Update: changed picture to one where Avilo has more viewers. The old picture can be viewed in this spoiler:
+ Show Spoiler +
[image loading]



Many thanks to all his wonderful fans who have supported him and helped him get featured by watching his stream, posting in the Featured Streamer Thread, and being a rockin' fan! Here are some of the posts in the featured streamer thread that helped him get featured. More will be added over time:
+ Show Spoiler +
On May 20 2013 11:01 Wojciech Zywny wrote:
Avilo is getting 300+ viewers atm. Think its about time for him to get featured imo.


On June 05 2013 15:59 fatalslaughter wrote:
Why not feature avilo? He puts out a lot of good content, and is very education and entertaining.


On June 06 2013 11:47 Kalfos wrote:
Requesting Avilo to be featured.


On June 06 2013 11:50 Wojciech Zywny wrote:
how is incontrol featured but not avilo??????


On June 06 2013 11:59 mtvacuum wrote:
I think Avilo should be featured. His extreme lategame style is very entertaining and he is also great at interacting with viewers.


On June 07 2013 02:35 Arkansassy wrote:
Show nested quote +
On June 06 2013 06:53 WaGGlez wrote:
A GM player that joins EG gets auto featured on TL? Good job on following the rules teamliquid.


I totally agree with this statement. It's disheartening to see so many players who deserve to be featured not get featured. And yes TeamLiquid actually broke their own rules, but it won't be the first time. That's just sad to me


On June 07 2013 07:38 BadBrain wrote:
I really think Avilo should be featured he is very entertaining... I just love watching him and i really have been improved a lot cuz of him!


On June 07 2013 07:39 Dzonson wrote:
I really think you should put Avilo to featured streams, becose his streams are really helfull and he streams regullarly, thank you !


On June 08 2013 07:49 Mecto wrote:
Old post on page #65, January 18 2013 09:03 :

---------------

Why not Avilo ? (as its been already proposed before)
He streams often, he's funny, entertaining and he's really good.

He currently plays Hots and test everythings out. and when i say everything, believe me, its everything possible ! Every strats you can think of. He also likes to interact with his chat, taking request on what he should do during a game (which strat to use, bio, mech, skyterran, anything really.)

He doesn't only play Hots, he'll play WoL at high level too, and from time to time, he'll stream other games such as Guild Wars 2.

He also runs a youtube channel, posting 20minutes + of Vlogs and Metagame updates for Hots, definitely something to check out; AviloStarcraft2

Avilo previously released a Replay Pack, and I'm sure he would be more than happy to release another one if people asked for it.

His long macro games are the best to watch (and to learn also), going through basically every kind of style possible.
Siege tank opening into mech, transitioning to BC/Raven and some nukes to get the game going.

Another reason ? Are you bored with the current Proleague's caster ? ME TOO.
Avilo will cast Proleague for you ! Yes he'll cast EG-TL owning korean's team, and that is awesome and entertaining
He'll talk from experience, analyse the game from another point of view, taking questions from the chat and throwing a joke here and there.

Having an average of 50-100 viewers and sometimes over 150 viewers unfeatured deserves a featured spot
As you can see, Avilo does a lot of stuff in the SC2 community, he has a passion for this awesome RTS game that is SC2. Avilo featured would be awesome

[edit; typo]

[edit#2] ok, so basically i went thought the 65 pages of this thread to see how many people support Avilo's featured spot as of today, here is the list;

Ewic, marine63, Razbu, dasbif, IVIiner, Arkansassy, Raw12, StringentShivan, Scizz,
voo05, redpanda8, gawdsed, Stumcro, OrD, Fistro, U_G_L_Y , An-Epic-Sanji, kill619,
Hollandrock, Christolight, Milestoned, Ma, benthekid, Cyanflame, bahunto28, Sc2Alucard,
The WingNut, vorxaw, ][Primarch][, dvorakftw, difused, zmansman17, IMoperator, Avarail,
disciple1776, chocolope1, XERtirips, Esk23, codonbyte, brian2sk8t, Steeb, NemoVII, Doodsmack,
Kronosya, 89733, Scoobasteve, oberhofer, rhs408, hermatic, Svetgm, MrGhosty, XERtirips, PanzerPony,
Barac, OmegaKnetus, darktosix, mLAN, WorkHorse, Psychobabas, Doominator10, GTZergy, Mischke,

62 individual requests, this is almost 1 requests per page! [Edit/Update: 0.95~~ request/page ]
Adding to the list myself and Avilo obviously, this would make it to 64 requests.

--------------- Avilo we refuse to watch if you don't play epic games 100% of the time ---------------

**Update**

I'll update this post every 8-10 pages or so, mostly because Avilo deserves it but also because Avilo is the current most requested Streamer right now ( by FAR )

Adding to the request list:

Acidrain77, URO, CaFStarWipe, ReachTheSky, DHD, Wojciech Zywny, fatalslaughter, Kalfos, mtvacuum, BadBrain, Dzonson. ( +11 requests over 7 pages )

Making the grand total to 75 singular requests. I think the most epic thing about this update is that we finally broke the 1 request per page !!! ( Currently 1.04~~ request/page )

Btw, congratulation on your recent 300+ viewers!

Time to get Avilo featured ! gogo !

[edit; typo]


On June 08 2013 08:04 dvorakftw wrote:
I think avilo should be featured not only because he deserves it but also to show this thread isn't a waste of time.


On June 08 2013 09:26 cpuser999 wrote:
I'm going to jump on this and post again about getting Avilo featured. I was unaware there were so many posts before me about this.

I've been watching him for ~2 years. He's not only entertaining but he knows more about the game than 95% of other streamers. He's incredibly intelligent, and streams all the time and plays intense macro games (I saw one last 2 and a half hours Blizzard time).

He's been in Grandmaster about 6-7 times, he streams every day for 6-7 hours at a time, sometimes twice a day; he's been on teams and to tournaments. He posts incredibly lengthy game analysis updates and Terran tricks and tips on YouTube.

It's really time to get Avilo more viewers and a feature spot. He's had it a long time coming. His viewer count is pretty damn good for a non-featured...averaging about 180-220 at a time. Oh yeah, and I'm a ZERG player, and I spend several hours a day watching Avilo.

Come on TL, lets get this done.


On June 08 2013 09:45 AyuReady wrote:
Vote Avilo for president! He plays Terran so you know (According to Blizzard) You will get exciting matches from him!


On June 09 2013 03:14 Arkansassy wrote:
Okay, I'll jump on the avilo bandwagon again.

He's put a lot of hard work into the growth of his stream. What confuses me is that the people who don't need the viewers get featured, but those awesome players who could use TLs help do not get featured. I've tried for a couple of years to understand this train of thought, but am at a loss.

Avilo is informative and has extremely intense games. Add to that his tenacity and sense of humor and you have a very entertaining streamer. He Mechs things happen in jaw-dropping match-ups where viewers are like "well avilo lost this one," and when he turns the game around for a win, viewers are like, "Huh? Did that just happen?"

He's long past due to be featured and it's obvious to a lot of people.




On June 10 2013 07:25 SYG wrote:
I know a lot of people have been saying stuf about avilo, but he really does need to be featured.

In the past week or so that I've been watching him, I've learned a LOT more about starcraft 2 in such a short amount of time that I could learn in maybe a year or so, and for someone just getting into starcraft seriously, that kind of information really helps!


On June 13 2013 08:09 AyuReady wrote:
AVILO should be featured :D I love watching him!


On June 13 2013 10:03 Gorribal wrote:
Avilo should be featured, guy's smart his only problem is not liking bio and early aggression and despite all of that he's GM.


On June 15 2013 13:46 Monchon wrote:
Avilo is a entertaining streamer. He is somewhat known and I think he deserves to be featured. PS, I joined TL thanks to Avilo's stream. I didn't know about this site and its helpful threads before.


On June 16 2013 12:03 Wojciech Zywny wrote:
avilo is currently getting 500+ viewers on his stream and isn't featured, while Protech, who is streaming, only have 135.

please get over your egos mods and just feature avilo already. I know you hate him for whatever reason but how about you try to be a little bit professional and do the right thing


On June 17 2013 04:09 gilesandmolly wrote:
avilo, you r such a good guy! i love your streams and your crazy freakiness! thanks for playing my replay, please keep it up!


On June 17 2013 11:54 MajorTom89 wrote:
Here to post for Avilo being featured.

The real appeal to Avilo's stream, beyond noteworthy skill, is that he is extremely entertaining in both his commentary and his play style. Since HotS release, he has improved his game as well as his attitude towards opponents. I have learned a great deal by watching his stream and I think other plays, Terran or otherwise, could do the same. Most importantly, Avilo's stream is welcoming both in his willingness to interact with his viewers and a generally friendly and amusing chat. Out of all of the players that I follow, Avilo is in my top 5 easily.

Please feature Avilo so more people can experience his awesome kung-fu nukage! SUP


On June 17 2013 13:41 Wafflelisk wrote:
Wow, everyone here is posting about Avilo lol.

For a selfish reason I'd like him featured because I spend lots of time on TL and it'd be nice to see him on the right.

(For what it's worth I was NOT nudged into coming here haha)


On June 17 2013 16:11 iCpryde wrote:
You should definitely feature Avilo, he's been doing really well on ladder and helps his streamers alot getting better at terran I have learned alot from him and he's really good alot better than some might give him credit for. Also hes super entertaining thumbs up for him being featured!


On June 18 2013 13:34 FreSH_LiKe_Uhhh wrote:
Feature AVILO!!!! Great Terran macro player!! And he talks to his viewers and answers questions. Also does game analysis! Avilo GOGOGOOG!!!


On June 20 2013 08:23 iiXenO wrote:
AVILO <3<3<3


On June 20 2013 11:37 chessnut333 wrote:
Please feature Avilo soon, he has a great stream that's both informative and entertaining(personality and play style).


On June 21 2013 11:37 Slabocans wrote:
Been watching Avilo lately.
I must say that he offers a great stream.
A lot of streamers get frustrated easily, cry about stream sniping, map hacking and other whinging when they lose.
This isn't enjoyable viewing.

Avilo on the other hand, explains what he is doing during the game, explains where he went wrong with a loss.
His has a character that other streamers lack, exciting theater after a win always worth a laugh.

An all round good vibe streamer.
Not to mention a great player, willing to try new things and not always stick to the 'meta' game.

GG Avilo


On June 24 2013 11:56 FreSH_LiKe_Uhhh wrote:
Why hasn't Avilo been featured yet?! Every time i log on, he is on! It's awesome! idk, maybe it's just been luck the past five times, but hey, i LOVE IT!!! Great Terran player; love the raven and mech play!! :D


On June 24 2013 13:30 NJantirice wrote:
Yeah Avilo is a grandmaster terran, one of the better players on twitch and definitely one of the better terrans why isn't he featured yet?


On August 14 2013 14:52 Incubus1993 wrote:
Please feature Avilo. His stream is on of the best around and probly the best Terran stream. He's really funny and does lots of Mech/Sky Terran games which is nice to see from all the bio we see all the time.

He plays really epic games really often please feature!


On August 18 2013 08:24 Weavel wrote:
Avilo sporting 600+ viewers again still not featured... TL please


On August 20 2013 15:43 cpuser999 wrote:
Someone please move Avilo to the featured streamers list. I'm watching him right now and he has more viewers than ROOTCatz. 502 viewers and I've seen him peak out at 611 at few days ago. Come on guys, this is a model SC player here!


On August 23 2013 11:20 Doodsmack wrote:
lol @ hellokitty being featured and PainUser being anywhere on that list, but avilo not being featured. It's been pretty clear for a while that avilo isn't featured due to TL mods' opinion of him. Let me guess, Fitzy and puck are still featured by virtue of being on ROOT? Oh that's right, Fitzy got 32nd at an MLG once.


On September 08 2013 06:53 TT1 wrote:
FEATURE AVILO, THE WORLD NEEDS MORE AVILO


On September 08 2013 08:03 Doodsmack wrote:
Who the hell is Tefel and why is he featured over Avilo? What has Naama done since winning a Korean-less Dreamhack in 2010 to deserve being featured over Avilo? Avilo is crushing their viewer numbers without being featured lol.

Really wish TL mods provided more reasoning for their featured streamer picks.
On September 08 2013 08:03 Doodsmack wrote:
Who the hell is Tefel and why is he featured over Avilo? What has Naama done since winning a Korean-less Dreamhack in 2010 to deserve being featured over Avilo? Avilo is crushing their viewer numbers without being featured lol.

Really wish TL mods provided more reasoning for their featured streamer picks.


On September 09 2013 12:49 dreamseller wrote:
i think it would be good for the SC2 scene for avilo to be featured/promoted on teamliquid. he is one of the few terran players that plays non-standard, and this is a breath of fresh air from the stagnant metagame.

whatever the differences he and the powers at teamliquid.net have had in the past need to be buried. the scene needs all the variety it can get.


On September 23 2013 12:17 Aveng3r wrote:
I understand the way avilo sometimes conducts himself on these boards, but I think he has a lot of fans and good enough stream numbers to be featured. I also sense that tl staff does not address what is keeping avilo from being featured.

Im actually watching him right now. He plays a pretty unique style, he just used a seeker missle and tanks to defend a blink all in. I feel like a lot of people would enjoy him if they gave him a chance
Procrastination is the enemy
OtoshimonoU
Profile Joined December 2011
United States509 Posts
Last Edited: 2012-04-08 01:17:20
April 08 2012 01:12 GMT
#2
Can we get a fresher Picture?

GOGO AVILO!

EDIT: Sick pictures of his games. Love the captions too!
God Young ho
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 08 2012 01:13 GMT
#3
Yeah, Otoshimono, if I find a fresher picture of him I'll rephotoshop the main image of him.
Procrastination is the enemy
IMoperator
Profile Joined October 2011
4476 Posts
April 08 2012 01:20 GMT
#4
I'm a huge fan, he really needs to be featured. Great player!
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2012-04-08 02:58:06
April 08 2012 01:27 GMT
#5
Good Job Codon. Thanks

Avilo deserves a fan club, so I'll sign up.
Ewic
Profile Joined May 2010
Canada121 Posts
April 08 2012 01:30 GMT
#6
Sign me up!!! Avilo fighting!
GrandMaster Terran
Bokacho
Profile Joined November 2011
Argentina7 Posts
April 08 2012 01:42 GMT
#7
Haha! GO GO GO Avilo (meaby must to put a picture with the "F$!%k Protoss" haha! )
Bokacho_7 / Argentina / www.starcraft-esp.com
Chicks
Profile Joined October 2010
Ireland63 Posts
April 08 2012 01:55 GMT
#8
I want in!
I stream here - http://www.twitch.tv/chickstv
gawdsed
Profile Joined April 2011
Canada32 Posts
April 08 2012 03:27 GMT
#9
I can vouch, avilo is not only entertaining but also a really good player... He deserves to get featured. He's always at the top of the terran non-featured list and plays in alot of tournaments.
Splitting, sieging, stutterstep, emping, muling, scanning, positioning, kiting, stimming, cloaking, are what makes terran ez-mode --The Zergs
Bajsgrodan
Profile Joined November 2010
Afghanistan408 Posts
April 08 2012 06:46 GMT
#10
Awesome player, really funny should get featured on TL, his stream is incredibly entertaining.
My name sucks!
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 08 2012 14:09 GMT
#11
On April 08 2012 15:46 Bajsgrodan wrote:
Awesome player, really funny should get featured on TL, his stream is incredibly entertaining.

I agree, man. I have no idea why he isn't featured. He's the first GM streamer I've seen who isn't featured. In addition to being an extremely talented and innovative player, he also interacts with his viewers quite a lot, which is something that many GM streamers just don't do.
Procrastination is the enemy
Kaitokid
Profile Blog Joined April 2011
Germany1327 Posts
April 08 2012 15:36 GMT
#12
On April 08 2012 23:09 codonbyte wrote:
Show nested quote +
On April 08 2012 15:46 Bajsgrodan wrote:
Awesome player, really funny should get featured on TL, his stream is incredibly entertaining.

I agree, man. I have no idea why he isn't featured. He's the first GM streamer I've seen who isn't featured. In addition to being an extremely talented and innovative player, he also interacts with his viewers quite a lot, which is something that many GM streamers just don't do.


There are a ton of GM players who are not featured and also players of a higher calibre than avilo, there are even GM players who get like 1-5 viewers everytime they stream. avilo at least gets a few hundred. Just wanted to correct you ^_^
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 08 2012 20:01 GMT
#13
On April 09 2012 00:36 Kaitokid wrote:
Show nested quote +
On April 08 2012 23:09 codonbyte wrote:
On April 08 2012 15:46 Bajsgrodan wrote:
Awesome player, really funny should get featured on TL, his stream is incredibly entertaining.

I agree, man. I have no idea why he isn't featured. He's the first GM streamer I've seen who isn't featured. In addition to being an extremely talented and innovative player, he also interacts with his viewers quite a lot, which is something that many GM streamers just don't do.


There are a ton of GM players who are not featured and also players of a higher calibre than avilo, there are even GM players who get like 1-5 viewers everytime they stream. avilo at least gets a few hundred. Just wanted to correct you ^_^

Do these players stream as regularly as Avilo does, though? Because it seems like not streaming regularly would really hurt your viewer count, and Avilo streams very regularly. Do these GM players who only get 1-5 viewers have sporadic streaming habits? Because if so, that would explain why they only have 1-5 viewers.
Procrastination is the enemy
Kaitokid
Profile Blog Joined April 2011
Germany1327 Posts
April 08 2012 21:19 GMT
#14
No idea if they stream regularly but my point is that avilo is far from being the only GM player who is not featured. There are also plenty of other good players who are not featured but often have a few hundred viewers, so hes not the only one in this situation.

I mean one can argue that he should be featured because he gets quite a lot of viewers considering he is not featured, but then again there are others who are not featured and even have like 10x more viewers than avilo. avilo is no special case, there are others in the same or similar streaming situation on TL.
OmegaKnetus
Profile Blog Joined October 2010
Germany431 Posts
April 08 2012 23:37 GMT
#15
Sign me up codon <3
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 09 2012 00:12 GMT
#16
On April 09 2012 08:37 OmegaKnetus wrote:
Sign me up codon <3

Done! Thanks for joining, man! :D
Procrastination is the enemy
slytown
Profile Blog Joined March 2011
Korea (South)1411 Posts
April 09 2012 01:02 GMT
#17
Add me. Sup Sassy.
The best Flash meme ever: http://imgur.com/zquoK
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2012-04-09 17:41:14
April 09 2012 17:17 GMT
#18
*waves hi to slytown.

I have to agree with Kaitokid on this one. There are so many superb players, who do not get recognized for one reason or another. Avilo is entertaining, informative, and GM. That, however, doesn't get you featured, according to TL rules.

The players he's coached were impressed with his coaching skills and ranked up within a week. Many players, who watch his stream regularly, comment that just watching him has helped them to rank up. That, according to TL rules, doesn't get you featured either.

Getting "hyped" and "invited" to tournaments seems to get you featured though. *shrugs* dunno. IMO, simply by observation and not based on fact, TL has never been a big fan of avilo.Fortunately, not everyone agrees.



banedroppa
Profile Joined March 2012
Sweden44 Posts
April 09 2012 18:33 GMT
#19
<3 avilio love ur rage vs protoss
asdqsgsfasf
Bajsgrodan
Profile Joined November 2010
Afghanistan408 Posts
April 09 2012 18:36 GMT
#20
sign me up I love this guys stream, most entertaining!
My name sucks!
xNomax
Profile Joined January 2012
Canada24 Posts
April 09 2012 19:41 GMT
#21
awesome stream! Funny guy, pure ownage sign me up!
crocodile
Profile Joined February 2011
United States615 Posts
April 09 2012 19:44 GMT
#22
Avilo is hilarious. Sign me up! I wish he would give TvP mech another chance though T_T
Master League Terran. Huge fan of Quantic Gaming and ROOTDestiny
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 09 2012 19:57 GMT
#23
Okay, Bajsgrodan, xNomax, and crocodile, you guys are signed up. Thanks for joining!!!

And crocodile, he's tried mech in TvP a LOT, and he's come to the conclusion that in wings of liberty, mech simply isn't viable against Protoss. I think there might be one map where he sometimes mechs against Protoss, but I'm not sure.
Procrastination is the enemy
crocodile
Profile Joined February 2011
United States615 Posts
April 09 2012 20:07 GMT
#24
Trust me, I listened to that rant on youtube. I know Avilo's points on mech in TvP. But I don't think he's playing it right.

I think he should revise his ideas from this video:


with some of the ideas of this video:


I've been playing mech TvP in master league for a while now. I firmly believe that with a core army of Tank/Thor/BC with Ghosts, making smart usage of sensor towers, vikings, ravens, planetary fortresses, and mobile barracks walls to control your engagements and make it so that protoss can never engage you favorably, you can go to late game in tvp extremely confident in your army superiority. I have many replays of myself doing this, although I'm obviously not as good as Avilo.

I think if Avilo could use his insane mechanics with this kind of strategy he could make mech TvP work easily. I'd love it if we could at least get him to consider this style and maybe try a few games again before writing it off.
Master League Terran. Huge fan of Quantic Gaming and ROOTDestiny
banedroppa
Profile Joined March 2012
Sweden44 Posts
April 09 2012 20:10 GMT
#25
sign me upp aswell
asdqsgsfasf
Hollandrock
Profile Joined January 2012
United Kingdom158 Posts
Last Edited: 2012-04-09 20:18:21
April 09 2012 20:16 GMT
#26
Probably my favourite stream! Ravens/nukes/mech - sign me up!
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 09 2012 20:27 GMT
#27
banedroppa and Hollandrock, you guys are now members of Avilo's fanclub! Congrats guys, and thanks for joining :D
Procrastination is the enemy
MountainGoat
Profile Blog Joined April 2011
United States507 Posts
April 09 2012 20:31 GMT
#28
Saw this guy playing IdrA and although he lost I was intrigued by his mech play and started checking out his stream. Found his youtube videos and liked the analysis and liked it as much as I liked his stream. Hope he continues to improve and make a name for himself.
myriad110
Profile Joined July 2011
Romania11 Posts
April 09 2012 21:07 GMT
#29
I want in :D
Avilo <3 ㅋㅋ
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 09 2012 21:13 GMT
#30
Done! Welcome to the club!
Procrastination is the enemy
RamonMcGrady
Profile Joined July 2011
33 Posts
April 09 2012 22:44 GMT
#31
This is not a serious Avilo's fanclub if I'm not in it
CaptainCharisma
Profile Joined February 2011
New Zealand808 Posts
April 09 2012 22:47 GMT
#32
Sign me up. I love Avilo's stream. Keep it up bro.
EG.DeMuslim --- EG.ThorZain --- TSL.Polt --- LGIMMvp --- Mill.fOrGG --- EG.Stephano --- EGiNcontroL --- EG.IdrA --- MarineKing.Prime --- SlayerS_MMA --- Liquid'Hero
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 09 2012 22:56 GMT
#33
Gradybunch and Charisma, welcome to the club! Thanks for joining :D
Procrastination is the enemy
Fishes
Profile Joined January 2011
United Kingdom47 Posts
April 09 2012 22:59 GMT
#34
<3 headband terran represent. Sign me up!
<3 Liquid
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 09 2012 23:00 GMT
#35
You're signed up fishes! :D
Procrastination is the enemy
AyaaLa
Profile Joined February 2012
Spain629 Posts
April 09 2012 23:03 GMT
#36
Sign me up. Avilo is a beast.
i balance whine all the time.
Twelvey
Profile Joined February 2012
2 Posts
April 10 2012 00:19 GMT
#37
Feature Avilo you dicks!!!
zmansman17
Profile Joined March 2011
United States2567 Posts
April 11 2012 17:28 GMT
#38
I <3 Avilo ^_^
♞ - His EKG is flattening get me a defib stat! Prepped and Ready! - ♞
Psychobabas
Profile Blog Joined March 2006
2531 Posts
April 11 2012 21:26 GMT
#39
please feature aviloooooo!!
Rick Deckard
Profile Joined October 2010
90 Posts
April 12 2012 18:11 GMT
#40
Please sign me up, Avilo's stream is great.
crocodile
Profile Joined February 2011
United States615 Posts
April 12 2012 19:16 GMT
#41
Avila owning protosses with tvp mech! Yes!
Master League Terran. Huge fan of Quantic Gaming and ROOTDestiny
k1ruaa
Profile Joined September 2011
17 Posts
April 14 2012 01:46 GMT
#42
Best stream ever for me
phiinix
Profile Blog Joined February 2011
United States1169 Posts
April 14 2012 01:50 GMT
#43
Been watching this stream a little more recently. It's pretty good and informative. It's long known that he loathes playing protoss, (imba imba) but as long as he keeps a positive mindset and tries to improve himself in the match up, I'll continue to watch. Certainly knowledgeable in the other match ups, I like watching his tvt
Ekhao
Profile Joined November 2011
Denmark2 Posts
April 14 2012 20:56 GMT
#44
lemme join too:D
namu.
Profile Joined January 2012
Germany9 Posts
April 15 2012 09:17 GMT
#45
sign me in asap
PassionsC
Profile Joined April 2012
United States42 Posts
April 16 2012 21:50 GMT
#46
SIGN EM UP


i love your ninja moves you do when u win a really good game =] along with sound effects
"herp derp"
( bush
Profile Joined April 2011
321 Posts
April 16 2012 23:52 GMT
#47
sign me

impressive lategame skills oO
!
oo
dakinaw
Profile Joined July 2008
United States11 Posts
April 17 2012 00:38 GMT
#48
im a big fan of avilo, sign me up!
GodFrog
Profile Joined October 2011
United States2 Posts
April 18 2012 12:00 GMT
#49
I want to be a mod for avilo, let me be mod in his stream awwwwwwwwww.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 18 2012 16:15 GMT
#50
On April 18 2012 21:00 GodFrog wrote:
I want to be a mod for avilo, let me be mod in his stream awwwwwwwwww.

I don't have the power to mod you, GodFrog, but I could make you a member of his fanclub. That will help you be a super fan of Avilo :D
Procrastination is the enemy
Strahl
Profile Joined April 2012
United Kingdom6 Posts
April 19 2012 20:22 GMT
#51
Sign me up! my alt ID which I use for twich is Dystop1anDream, you guys might recognise me, I like to hang out in avilo's chat a lot. Let's get him featured!
FreSH_LiKe_Uhhh
Profile Joined April 2012
United States14 Posts
April 19 2012 21:03 GMT
#52
Avilo is one crazy a$$ Terran mofo, but he def has skill n knowledge of the game. Also a very entertaining streamer! I know we all love it when he gets crazy and screams in your earphones! hahah keep it FreSH Avilo!
FXOTheoRy
Profile Blog Joined July 2008
United States519 Posts
April 19 2012 22:31 GMT
#53
YEEE AVILO. sign LgNTheoRy up!! =D
oyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoy
Arkansassy
Profile Joined October 2010
358 Posts
April 21 2012 03:20 GMT
#54
Just curious and perhaps someone here has the answer. Whilst going through TLs featured list, I came upon:

CaucasianAsian with 60 viewers - featured. Couldn't find a list of major tournaments that he's won.

I'm not going to list all of the featured players that I've seen today and in the past, but truly believe this is an example of TLs double standards. Maybe I just don't understand the criteria TL uses to deem someone worthy of being featured. Or maybe I overlooked something in their policy. hmmm.
vOdToasT
Profile Blog Joined September 2010
Sweden2870 Posts
April 21 2012 03:46 GMT
#55
On April 21 2012 12:20 Arkansassy wrote:
Just curious and perhaps someone here has the answer. Whilst going through TLs featured list, I came upon:

CaucasianAsian with 60 viewers - featured. Couldn't find a list of major tournaments that he's won.

I'm not going to list all of the featured players that I've seen today and in the past, but truly believe this is an example of TLs double standards. Maybe I just don't understand the criteria TL uses to deem someone worthy of being featured. Or maybe I overlooked something in their policy. hmmm.


He re streamed proffessional Brood War, that's why he got featured. And they do that to anyone who does it on a consistent basis, so there are no double standards here.
If it's stupid but it works, then it's not stupid* (*Or: You are stupid for losing to it, and gotta git gud)
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 21 2012 03:57 GMT
#56
On April 21 2012 12:20 Arkansassy wrote:
Just curious and perhaps someone here has the answer. Whilst going through TLs featured list, I came upon:

CaucasianAsian with 60 viewers - featured. Couldn't find a list of major tournaments that he's won.

I'm not going to list all of the featured players that I've seen today and in the past, but truly believe this is an example of TLs double standards. Maybe I just don't understand the criteria TL uses to deem someone worthy of being featured. Or maybe I overlooked something in their policy. hmmm.

I hate to say it Arkansassy, but I've gotten the feeling that TL.net does not really like people who openly express their opinions on balance. Also, I have a sneaking suspicion that the fact that Terran was OP in the beta and just after release may have made some of them biased, and that that could cause them to hate on a Terran player who complains about balance more than they would a Protoss or Zerg player. I could be wrong, but this is just the feeling that I've gotten from hanging around TL.
Procrastination is the enemy
Arkansassy
Profile Joined October 2010
358 Posts
April 21 2012 06:26 GMT
#57
On April 21 2012 12:46 vOdToasT wrote:
Show nested quote +
On April 21 2012 12:20 Arkansassy wrote:
Just curious and perhaps someone here has the answer. Whilst going through TLs featured list, I came upon:

CaucasianAsian with 60 viewers - featured. Couldn't find a list of major tournaments that he's won.

I'm not going to list all of the featured players that I've seen today and in the past, but truly believe this is an example of TLs double standards. Maybe I just don't understand the criteria TL uses to deem someone worthy of being featured. Or maybe I overlooked something in their policy. hmmm.


He re streamed proffessional Brood War, that's why he got featured. And they do that to anyone who does it on a consistent basis, so there are no double standards here.


Thank you for your response, vOdToast, but I just cited one example, of many that I've questioned from time to time. I'm sure there's a logical answer for each of them so, I won't waste anyones time by listing them all. I was simply curious.





Arkansassy
Profile Joined October 2010
358 Posts
April 21 2012 06:29 GMT
#58
On April 21 2012 12:57 codonbyte wrote:
Show nested quote +
On April 21 2012 12:20 Arkansassy wrote:
Just curious and perhaps someone here has the answer. Whilst going through TLs featured list, I came upon:

CaucasianAsian with 60 viewers - featured. Couldn't find a list of major tournaments that he's won.

I'm not going to list all of the featured players that I've seen today and in the past, but truly believe this is an example of TLs double standards. Maybe I just don't understand the criteria TL uses to deem someone worthy of being featured. Or maybe I overlooked something in their policy. hmmm.

I hate to say it Arkansassy, but I've gotten the feeling that TL.net does not really like people who openly express their opinions on balance. Also, I have a sneaking suspicion that the fact that Terran was OP in the beta and just after release may have made some of them biased, and that that could cause them to hate on a Terran player who complains about balance more than they would a Protoss or Zerg player. I could be wrong, but this is just the feeling that I've gotten from hanging around TL.



LOL, Codon, very interesting.
FreSH_LiKe_Uhhh
Profile Joined April 2012
United States14 Posts
April 21 2012 19:02 GMT
#59
Wish he would stop off-racing as Toss... I feel like its dumbing him down.. no disrespect bro!
OtoshimonoU
Profile Joined December 2011
United States509 Posts
Last Edited: 2012-04-23 02:24:16
April 23 2012 02:23 GMT
#60
Ski mask
God Young ho
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 23 2012 02:49 GMT
#61
On April 23 2012 11:23 OtoshimonoU wrote:
Ski mask

I am just... so confused....
Procrastination is the enemy
Arkansassy
Profile Joined October 2010
358 Posts
April 23 2012 03:13 GMT
#62
On April 23 2012 11:49 codonbyte wrote:
Show nested quote +
On April 23 2012 11:23 OtoshimonoU wrote:
Ski mask

I am just... so confused....


lol... don't be confused, codon. avilo was being funny and when I got on stream and saw the mask, I didn't think it was funny. . I acted precipitously and implied something I should not have. My temper is my biggest flaw and that's why I'm smart enough not to carry a gun.

Sorry, for disrrupting the stream.
FreSH_LiKe_Uhhh
Profile Joined April 2012
United States14 Posts
April 24 2012 21:42 GMT
#63
YOMT Tourney tonight! Make us proud boyyyyy!! ;]
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 24 2012 22:26 GMT
#64
OMG yes! I can't wait for the tourney!! :D
Procrastination is the enemy
Kiri
Profile Joined November 2010
United States84 Posts
April 24 2012 22:48 GMT
#65
Hey guys i'm xOKiri.248, and a long time fan of Avilo. Would you mind adding me to the fan club and linking or sending me replays of avilo doing battlecruiser builds?? Late game mass bcs vs toss in that one game or even mid-game or bc rushes in any match up =]
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 25 2012 00:27 GMT
#66
YAAAAAAY AVILO BEAT SLEEP IN FIRST GAME YAAAAAAY!!!!!!!!
Procrastination is the enemy
acgFork
Profile Blog Joined May 2011
Canada397 Posts
April 25 2012 00:30 GMT
#67
Sign me up. This guy deserves way more attention than he gets at the moment.

Keep pwning man, and good luck with getting some good results!
acgFork 208
GodFrog
Profile Joined October 2011
United States2 Posts
April 25 2012 06:04 GMT
#68
YAAY AVILO IM A HUGE HUGE SUPER HUGE MEGA HUGE FAN, CAN I BE MOD ON YOUR STREAM BECAUSE ONLY A TRUE FAN LIKE MYSELF HAS PROVEN TIME AND TIME AGAIN THAT I AM A SUPER FAN. ALL THE PEOPLE ON YOUR CHAT ARE HATERS BECAUSE THEY CAN'T STAND THAT SOMEONE LIKE ME IS MORE OF A FAN THAN THEY ARE SO THEY TRY TO DO EVERYTHING IN THERE POWER TO SILENCES ME, BUT I WILL NOT BE SILENCES BY THE LIKES OF LOW FANS BECAUSE IM A TRUE SUPER FAN. I WILL SAY AVILO IS THE BEST WHEN I WANT AND HOW I WANT BECAUSE AVILO IS THE BEST, NOW PLEASE PLEASE MAKE ME A MOD BECAUSE SOME OF THE MODS ON YOUR STREAM ARE VERY BAD AND I CAN DO A LOT BETTER.

lOVE BY YOUR FAVORITE FAN FROG...


User was temp banned for this post.
MenithZ
Profile Joined April 2012
France21 Posts
April 25 2012 06:16 GMT
#69
Been watching this stream for days in and days out he is truly one of the more talented players in the player pool and I hope to see him excel in more tournaments. His team is also very good, they seem to nurture him with their sick lineup of players. was a shame desrow left though, he fit in quite well. Good luck to Avilo and LgN .
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2012-04-25 09:02:39
April 25 2012 08:13 GMT
#70
On April 25 2012 15:04 GodFrog wrote:
YAAY AVILO IM A HUGE HUGE SUPER HUGE MEGA HUGE FAN, CAN I BE MOD ON YOUR STREAM BECAUSE ONLY A TRUE FAN LIKE MYSELF HAS PROVEN TIME AND TIME AGAIN THAT I AM A SUPER FAN. ALL THE PEOPLE ON YOUR CHAT ARE HATERS BECAUSE THEY CAN'T STAND THAT SOMEONE LIKE ME IS MORE OF A FAN THAN THEY ARE SO THEY TRY TO DO EVERYTHING IN THERE POWER TO SILENCES ME, BUT I WILL NOT BE SILENCES BY THE LIKES OF LOW FANS BECAUSE IM A TRUE SUPER FAN. I WILL SAY AVILO IS THE BEST WHEN I WANT AND HOW I WANT BECAUSE AVILO IS THE BEST, NOW PLEASE PLEASE MAKE ME A MOD BECAUSE SOME OF THE MODS ON YOUR STREAM ARE VERY BAD AND I CAN DO A LOT BETTER.

lOVE BY YOUR FAVORITE FAN FROG...


User was temp banned for this post.

Oh. My. God. This made my night. I like Godfrog, but I'd had it up to here with him this evening, and seeing this after playing Runling Run... it made my evening. I couldn't stop laughing. And the entry in the automated ban list... Well, you have to check that out for yourself by clicking HERE

:D :D still rotflol :D :D
Procrastination is the enemy
OmegaKnetus
Profile Blog Joined October 2010
Germany431 Posts
April 25 2012 18:39 GMT
#71
On April 25 2012 17:13 codonbyte wrote:
Show nested quote +
On April 25 2012 15:04 GodFrog wrote:
YAAY AVILO IM A HUGE HUGE SUPER HUGE MEGA HUGE FAN, CAN I BE MOD ON YOUR STREAM BECAUSE ONLY A TRUE FAN LIKE MYSELF HAS PROVEN TIME AND TIME AGAIN THAT I AM A SUPER FAN. ALL THE PEOPLE ON YOUR CHAT ARE HATERS BECAUSE THEY CAN'T STAND THAT SOMEONE LIKE ME IS MORE OF A FAN THAN THEY ARE SO THEY TRY TO DO EVERYTHING IN THERE POWER TO SILENCES ME, BUT I WILL NOT BE SILENCES BY THE LIKES OF LOW FANS BECAUSE IM A TRUE SUPER FAN. I WILL SAY AVILO IS THE BEST WHEN I WANT AND HOW I WANT BECAUSE AVILO IS THE BEST, NOW PLEASE PLEASE MAKE ME A MOD BECAUSE SOME OF THE MODS ON YOUR STREAM ARE VERY BAD AND I CAN DO A LOT BETTER.

lOVE BY YOUR FAVORITE FAN FROG...


User was temp banned for this post.

Oh. My. God. This made my night. I like Godfrog, but I'd had it up to here with him this evening, and seeing this after playing Runling Run... it made my evening. I couldn't stop laughing. And the entry in the automated ban list... Well, you have to check that out for yourself by clicking HERE

:D :D still rotflol :D :D


lol that ban reasoning :D Seems like the mods still have some fun in this horrendous troll-swamp

aMEkaRmy
Profile Blog Joined December 2010
Canada633 Posts
April 27 2012 00:35 GMT
#72
sign me up gogo
Team Captain for FXO.NA Follow me on twitter @FXOkarmy
zmansman17
Profile Joined March 2011
United States2567 Posts
May 01 2012 03:32 GMT
#73
I love Avilo. I will say it once, I will say it a thousand times. Go Avilo!
♞ - His EKG is flattening get me a defib stat! Prepped and Ready! - ♞
humblecoder
Profile Joined January 2012
United States2 Posts
May 01 2012 03:59 GMT
#74
add por favor!
aintthatfunny
Profile Joined April 2012
193 Posts
May 01 2012 17:57 GMT
#75
Class act kid. DQ somebody without even messaging them, while having the wrong contact details. Pathetic really.
I promise I'll behave.
chambertin
Profile Joined August 2011
United States1704 Posts
May 04 2012 16:15 GMT
#76
is anyone else getting the 2032 error right now? only with avilo, other twitch is fine....

also, sign me up
"I know one thing, that I know nothing" - Socrates?
Sc2Alucard
Profile Joined September 2011
Switzerland5 Posts
May 07 2012 14:13 GMT
#77
Add me to the fan club ^^
FreSH_LiKe_Uhhh
Profile Joined April 2012
United States14 Posts
May 07 2012 20:07 GMT
#78
yea add me to the club too, this guy is hilarious. Anyone ever see his victory dances?!?! SO OP!!
rockerfella99
Profile Joined December 2011
4 Posts
May 10 2012 01:12 GMT
#79
erm. lemme in codon

ty ty
b0ats
Profile Joined August 2010
5 Posts
May 14 2012 05:10 GMT
#80
GOGO AVILO YAYAYAYAYA
b0ats
Profile Joined August 2010
5 Posts
May 14 2012 05:11 GMT
#81
also sign me up:D
MegaFonzie
Profile Joined April 2011
Australia1084 Posts
May 14 2012 09:14 GMT
#82
Did he end up switching to Zerg like he said on twitter?
@x5_MegaFonzie
PuLsai
Profile Joined January 2012
England4 Posts
May 14 2012 22:08 GMT
#83
I thought i did this before but i guess i was wrong :p sign me up :D:D:D <3
Geee Geeee!!! :)
LicoriceCoke
Profile Joined April 2012
Canada1 Post
Last Edited: 2012-05-17 00:34:21
May 17 2012 00:33 GMT
#84
this guy is the best streamer I've ever seen.

can't believe he doesn't pull bigger numbers. it prbly has something to do with him not being feature on tl

edit: oh yeah, sign me up!
IMoperator
Profile Joined October 2011
4476 Posts
May 17 2012 06:28 GMT
#85
Nice job winning Playhem, looking forward to seeing you play in Anaheim :D
codonbyte
Profile Blog Joined June 2011
United States840 Posts
May 17 2012 06:29 GMT
#86
OMG YAAAAAAAAY AVILO WON PLAYHEM TOURNAMENT WITH EPIC ZERG GAME WITH MECH AND DEAD ZERG BUGS!!!!!!!! YAAAAAY!!! HE'S GONNA GO ON A PLANE AND GO TO MLG AND PLAY IN TOURNAMENTS AND YAY AND AAAAAAAAAAYYYY!!!!!!!!!!!!!!!!11
Procrastination is the enemy
Ralethon
Profile Joined July 2011
United States141 Posts
May 17 2012 06:50 GMT
#87
On May 17 2012 15:29 codonbyte wrote:
OMG YAAAAAAAAY AVILO WON PLAYHEM TOURNAMENT WITH EPIC ZERG GAME WITH MECH AND DEAD ZERG BUGS!!!!!!!! YAAAAAY!!! HE'S GONNA GO ON A PLANE AND GO TO MLG AND PLAY IN TOURNAMENTS AND YAY AND AAAAAAAAAAYYYY!!!!!!!!!!!!!!!!11


Couldnt have said it better myself! Sign me up please!
Starshaped
Profile Blog Joined December 2009
Sweden575 Posts
May 17 2012 11:33 GMT
#88
Who did Avilo play in the finals? Any link to the bracket?
My Starcraft 2, gaming and e-sports-related blog: http://starshapedthoughts.blogspot.com/
vorxaw
Profile Joined April 2011
Canada245 Posts
May 17 2012 20:40 GMT
#89
sign me up, been watching his stream for forever, his passion for the game really makes it feel more like a sport than any other streamer
Lifter
Profile Joined April 2011
United States126 Posts
May 18 2012 03:10 GMT
#90
Saw the reddit post, congrats Avilo!
IMoperator
Profile Joined October 2011
4476 Posts
May 18 2012 03:24 GMT
#91
On May 17 2012 20:33 Starshaped wrote:
Who did Avilo play in the finals? Any link to the bracket?

BnYWompbeatz in the finals.
Kiri
Profile Joined November 2010
United States84 Posts
May 21 2012 01:42 GMT
#92
Is this thread updated with replays etc.?
Polar_Nada
Profile Blog Joined June 2008
United States1548 Posts
May 21 2012 01:47 GMT
#93
sign me up. this guy is such a baller.
[ReD]NaDa and fnaticMSI.SEn fighting~! ::POlar @ UC Irvine::
DG.Zeya
Profile Joined January 2012
United States39 Posts
May 29 2012 19:38 GMT
#94
I've been watching avilo for about a year now, and boy is he a great player, not to mention that his stream is a fun place to hang out. He does some freaking awesome plays with nukes, battlecruisers, reapers, etc. So hells yeah, sign me up! (And as Arkansassy might say, it's about damn time!)
Christolight
Profile Joined December 2011
United States46 Posts
May 29 2012 20:14 GMT
#95
YoYoYo Avilo!...I am yer big fan here Avilo....keel all Aliens!
Lets get Dangerous!
jazzhawg
Profile Joined June 2012
United States2 Posts
June 03 2012 01:26 GMT
#96
What are you Crazy, hell yeah sign me up!!! You make steaming entertaining. You need to coach the rest of those boring steamers on twitch on how to do it!!! The F**k Protoss beanie is priceless!!!! LMFAO the first time I saw it. The video steam about the new patch was hilarious and right on!!! Avilo for President is what I think. :-]
Get Some!!!
ClassicThunder
Profile Blog Joined May 2012
United States11 Posts
June 09 2012 01:56 GMT
#97
When does he play in MLG and where can I see the results of his games?
FeeLdAfuRy
Profile Joined October 2002
Australia290 Posts
June 09 2012 02:43 GMT
#98
http://wiki.teamliquid.net/starcraft2/2012_StarCraft_II_World_Championship_Series/North_America/Nationals/USA

Results here. Still alive in the losers bracket

Avilo hwaiting!!!
ClassicThunder
Profile Blog Joined May 2012
United States11 Posts
June 09 2012 05:42 GMT
#99
Thank you. He's up against fizzy then idra. Very tough couple of zergs to get though.
RiPPy
Profile Joined March 2012
Norway23 Posts
June 09 2012 09:02 GMT
#100
Disappointing performance Avilo, first of all knocked down to loosers in a tvt vs a "nobody" and knocked out by fitzyhere..???
Also considering you didnt make it to GM the whole season i dont think ur at ur A-game.
Might sound cruel but, avilo is an athlete am a fan, and fans demand results like any other sport!

Good luck next time.
avilo
Profile Blog Joined November 2007
United States4100 Posts
June 09 2012 09:13 GMT
#101
On June 09 2012 18:02 RiPPy wrote:
Disappointing performance Avilo, first of all knocked down to loosers in a tvt vs a "nobody" and knocked out by fitzyhere..???
Also considering you didnt make it to GM the whole season i dont think ur at ur A-game.
Might sound cruel but, avilo is an athlete am a fan, and fans demand results like any other sport!

Good luck next time.


lol gtfo.
Sup
Steelo_Rivers
Profile Blog Joined January 2011
United States1968 Posts
June 09 2012 09:18 GMT
#102
On June 09 2012 18:02 RiPPy wrote:
Disappointing performance Avilo, first of all knocked down to loosers in a tvt vs a "nobody" and knocked out by fitzyhere..???
Also considering you didnt make it to GM the whole season i dont think ur at ur A-game.
Might sound cruel but, avilo is an athlete am a fan, and fans demand results like any other sport!

Good luck next time.

-_-"

simon cowell?
ok
Ma
Profile Joined February 2012
United Kingdom92 Posts
Last Edited: 2012-06-09 14:05:52
June 09 2012 14:05 GMT
#103
On June 09 2012 18:02 RiPPy wrote:
Disappointing performance Avilo, first of all knocked down to loosers in a tvt vs a "nobody" and knocked out by fitzyhere..???
Also considering you didnt make it to GM the whole season i dont think ur at ur A-game.
Might sound cruel but, avilo is an athlete am a fan, and fans demand results like any other sport!

Good luck next time.



Don't be ridiculous...

Look at the mlg open bracket and you'll see fitzy also 2-0'd zenio
Taeja, Hero, MVP, Grubby, Polt, MKP FIGHTING
Najzmajs
Profile Joined February 2012
Sweden105 Posts
June 09 2012 14:13 GMT
#104
HE SHALL NOT CHANGE!
Hi! O,o
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2012-06-09 17:08:08
June 09 2012 17:05 GMT
#105
Hey, codon, isn't there a way to keep haters out of avilo's fan club?

Seems to me that you have had to be raised pretty poorly to be ignorant enough to come into a fan club and kick someone when they're down. *shrugs
zmansman17
Profile Joined March 2011
United States2567 Posts
Last Edited: 2012-06-11 05:37:52
June 09 2012 19:34 GMT
#106
On June 09 2012 18:18 AeroEffect wrote:
Show nested quote +
On June 09 2012 18:02 RiPPy wrote:
Disappointing performance Avilo, first of all knocked down to loosers in a tvt vs a "nobody" and knocked out by fitzyhere..???
Also considering you didnt make it to GM the whole season i dont think ur at ur A-game.
Might sound cruel but, avilo is an athlete am a fan, and fans demand results like any other sport!

Good luck next time.

-_-"

simon cowell?


Yeah I'm not sure if you knew but he actually LOVES starcraft. I guess he can't control his outbursts. (referring to simon cowell who apparently is a recent critic)
♞ - His EKG is flattening get me a defib stat! Prepped and Ready! - ♞
codonbyte
Profile Blog Joined June 2011
United States840 Posts
June 17 2012 19:04 GMT
#107
On June 10 2012 02:05 Arkansassy wrote:
Hey, codon, isn't there a way to keep haters out of avilo's fan club?

Seems to me that you have had to be raised pretty poorly to be ignorant enough to come into a fan club and kick someone when they're down. *shrugs


Hey sassy, sorry I didn't see this sooner. I'll PM a mod about this, see if they can do something about it. I know TL has very little tolerance for people trolling a player in their own fan-club.
Procrastination is the enemy
bahunto28
Profile Joined October 2010
Canada262 Posts
June 19 2012 02:31 GMT
#108
anyone know when avilo is going to be streaming next? i've not seen him on in awhiles. or is he secretly working on new HotS mech builds? :D

=> sassy => the internet lets people be anyone they want, some people choose to be a-holes. kinda sad really.
meh
Steelo_Rivers
Profile Blog Joined January 2011
United States1968 Posts
June 19 2012 02:49 GMT
#109
avilocakes
ok
CaptainCharisma
Profile Joined February 2011
New Zealand808 Posts
June 21 2012 12:06 GMT
#110
So it looks like ST_Ace decided that putting HTs in a warp prism and unloading them to storm is a good idea.


I wonder how long it will take for more Protoss to start using strategies that Avilo said Toss should be using about 3 months ago?
EG.DeMuslim --- EG.ThorZain --- TSL.Polt --- LGIMMvp --- Mill.fOrGG --- EG.Stephano --- EGiNcontroL --- EG.IdrA --- MarineKing.Prime --- SlayerS_MMA --- Liquid'Hero
Chaggi
Profile Joined August 2010
Korea (South)1936 Posts
June 21 2012 12:13 GMT
#111
On June 21 2012 21:06 CaptainCharisma wrote:
So it looks like ST_Ace decided that putting HTs in a warp prism and unloading them to storm is a good idea.


I wonder how long it will take for more Protoss to start using strategies that Avilo said Toss should be using about 3 months ago?


they've been doing that forever
CaptainCharisma
Profile Joined February 2011
New Zealand808 Posts
June 21 2012 13:29 GMT
#112
On June 21 2012 21:13 Chaggi wrote:
Show nested quote +
On June 21 2012 21:06 CaptainCharisma wrote:
So it looks like ST_Ace decided that putting HTs in a warp prism and unloading them to storm is a good idea.


I wonder how long it will take for more Protoss to start using strategies that Avilo said Toss should be using about 3 months ago?


they've been doing that forever



Not enough then.
EG.DeMuslim --- EG.ThorZain --- TSL.Polt --- LGIMMvp --- Mill.fOrGG --- EG.Stephano --- EGiNcontroL --- EG.IdrA --- MarineKing.Prime --- SlayerS_MMA --- Liquid'Hero
Arkansassy
Profile Joined October 2010
358 Posts
June 21 2012 17:47 GMT
#113
On June 19 2012 11:31 bahunto28 wrote:
anyone know when avilo is going to be streaming next? i've not seen him on in awhiles. or is he secretly working on new HotS mech builds? :D

=> sassy => the internet lets people be anyone they want, some people choose to be a-holes. kinda sad really.


I don't want to speak for avilo. Don't know when he'll be streaming again. He's totally disillusioned with the game and the community. When he streams, he'll tweet it for sure. With the help of his fans, he'll rise above this bs and be back again in full force. Don't give up on him - he needs y'all now more than ever.

LOL about internet people being a-holes...I can name quite a few in the SC community alone, but I'll restrain myself.
Ma
Profile Joined February 2012
United Kingdom92 Posts
June 21 2012 18:58 GMT
#114
On June 22 2012 02:47 Arkansassy wrote:
Show nested quote +
On June 19 2012 11:31 bahunto28 wrote:
anyone know when avilo is going to be streaming next? i've not seen him on in awhiles. or is he secretly working on new HotS mech builds? :D

=> sassy => the internet lets people be anyone they want, some people choose to be a-holes. kinda sad really.


I don't want to speak for avilo. Don't know when he'll be streaming again. He's totally disillusioned with the game and the community. When he streams, he'll tweet it for sure. With the help of his fans, he'll rise above this bs and be back again in full force. Don't give up on him - he needs y'all now more than ever.

LOL about internet people being a-holes...I can name quite a few in the SC community alone, but I'll restrain myself.



T___T

I just read some of the stuff on the SOTG thread. Incontrol is such a 'rancid fuck', jesus christ.

Avilo, don't listen to these losers, sooner or later people will realise the truth. There's not really much point in trying to argue with someone who pretends to be 'nuanced' and 'logical', when the reality is that they need to resort to petty insults at the beginning of each post. Just carry on practising and you'll get to where you wanna go.
Taeja, Hero, MVP, Grubby, Polt, MKP FIGHTING
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2012-06-21 20:04:58
June 21 2012 20:03 GMT
#115
On June 22 2012 03:58 Ma wrote:
Show nested quote +
On June 22 2012 02:47 Arkansassy wrote:
On June 19 2012 11:31 bahunto28 wrote:
anyone know when avilo is going to be streaming next? i've not seen him on in awhiles. or is he secretly working on new HotS mech builds? :D

=> sassy => the internet lets people be anyone they want, some people choose to be a-holes. kinda sad really.


I don't want to speak for avilo. Don't know when he'll be streaming again. He's totally disillusioned with the game and the community. When he streams, he'll tweet it for sure. With the help of his fans, he'll rise above this bs and be back again in full force. Don't give up on him - he needs y'all now more than ever.

LOL about internet people being a-holes...I can name quite a few in the SC community alone, but I'll restrain myself.



T___T

I just read some of the stuff on the SOTG thread. Incontrol is such a 'rancid fuck', jesus christ.

Avilo, don't listen to these losers, sooner or later people will realise the truth. There's not really much point in trying to argue with someone who pretends to be 'nuanced' and 'logical', when the reality is that they need to resort to petty insults at the beginning of each post. Just carry on practising and you'll get to where you wanna go.


Thanks for your words of encouragement I'm directing avilo to all the good things people have to say about him and trying to keep him away from the haters.
ScoobyBR
Profile Joined September 2011
Brazil3 Posts
June 22 2012 05:08 GMT
#116
Sups,
I'm big fan.
I have no idea whats been said but I really don't care(especially if i comes from inctrl).
Now, that being said there's something I do care about; I've been missing some sick mech play from Avilo. GET STREAMING GUY!
Much love from Brasil!
HeathenHill
Profile Joined January 2012
Australia22 Posts
June 24 2012 15:26 GMT
#117
Probs my favourite stream. Mech, Nukes, Strategy, Chat, Ranting and random outbursts. It's all good.
.Are we not the undisputed prodigy of warfare.
Arkansassy
Profile Joined October 2010
358 Posts
June 25 2012 17:13 GMT
#118
Hi Scooby...HeathenHill

@Scooby, avilo has been streaming, but not during his regular hours.

Thank you both for your support. It's greatly appreciated. Codonbyte will be sure to add your names to avilo's fan club.
Enel
Profile Joined April 2012
Sudan430 Posts
June 29 2012 02:28 GMT
#119
avilo 1-0 idra
Go Sudan
IMoperator
Profile Joined October 2011
4476 Posts
June 29 2012 02:30 GMT
#120
We support you avilo! <3 Good to see that you didn't resort to personal attacks like Geoff and Idra both did. You were definitely the bigger man in that debate. Idra is just a childlish prick that couldn't stand having to argue vs. someone that he didn't like very much in the first place.
iky43210
Profile Blog Joined May 2011
United States2099 Posts
June 29 2012 04:03 GMT
#121
you definitely came out as a winner in today's SOTG. You were much more well mannered and definitely got alot of props and PR to viewers
Disposition1989
Profile Blog Joined March 2011
Canada270 Posts
June 29 2012 04:11 GMT
#122
On June 29 2012 13:03 iky43210 wrote:
you definitely came out as a winner in today's SOTG. You were much more well mannered and definitely got alot of props and PR to viewers


echoing this. you were the man and they were the brats
Starshaped
Profile Blog Joined December 2009
Sweden575 Posts
June 29 2012 04:19 GMT
#123
Hope you weren't too hurt by the way you were treated <3
My Starcraft 2, gaming and e-sports-related blog: http://starshapedthoughts.blogspot.com/
Mosquito
Profile Joined December 2010
Sweden63 Posts
June 29 2012 15:10 GMT
#124
Avilo - Idra 1-0
Wave goodbye to the past, you got your whole life to lead
eipxen
Profile Joined April 2011
23 Posts
June 29 2012 16:07 GMT
#125
I didn't watch you in any previous SOTG, but in last night's you had remarkable composure, and did a good job representing your community. Whether your argument was the right one or not was not the point: it was an opinion that was being put up for debate, and Greg could not even control his temper for long enough to debate it legitimately.

You did your community proud, and I hope that is enough.
Benjamin99
Profile Joined April 2012
4176 Posts
June 29 2012 16:24 GMT
#126
Sign me up you came out as a coldheaded and rational person even though they bullied you and took potshoots on you all the time you never returned the favor!
Stephano & Jaedong <-- The Pain Train. Polt and Innovation to EG plz
[DekAr]
Profile Joined February 2011
United States59 Posts
June 29 2012 16:39 GMT
#127
On June 30 2012 01:24 Benjamin99 wrote:
Sign me up you came out as a coldheaded and rational person even though they bullied you and took potshoots on you all the time you never returned the favor!


Before making some point, avilo said to Idra "without taking cheap shots at you, like you did at me."

That's returning the favor.

That being said, I enjoy watching avilo once in awhile for the mech play, don't care for the rage.
Zorkmid
Profile Joined November 2008
4410 Posts
June 29 2012 17:12 GMT
#128
Keep your chin up man, don't worry about what the SoTG clique thinks, they're just smelling themselves.
CCsyph
Profile Joined May 2012
United Kingdom97 Posts
June 29 2012 17:20 GMT
#129
On June 30 2012 01:39 [DekAr] wrote:
Show nested quote +
On June 30 2012 01:24 Benjamin99 wrote:
Sign me up you came out as a coldheaded and rational person even though they bullied you and took potshoots on you all the time you never returned the favor!


Before making some point, avilo said to Idra "without taking cheap shots at you, like you did at me."

That's returning the favor.

That being said, I enjoy watching avilo once in awhile for the mech play, don't care for the rage.

That is not returning the favour, in fact it is anything but.
IdrA went ad hominem, Avilo pointed it out.
"I hear you speak and suddenly I'm reminded of how the people I respected most in my life had a problem with authority."
Benjamin99
Profile Joined April 2012
4176 Posts
June 29 2012 17:32 GMT
#130
On June 30 2012 01:39 [DekAr] wrote:
Show nested quote +
On June 30 2012 01:24 Benjamin99 wrote:
Sign me up you came out as a coldheaded and rational person even though they bullied you and took potshoots on you all the time you never returned the favor!


Before making some point, avilo said to Idra "without taking cheap shots at you, like you did at me."

That's returning the favor
.

That being said, I enjoy watching avilo once in awhile for the mech play, don't care for the rage.


what?
Stephano & Jaedong <-- The Pain Train. Polt and Innovation to EG plz
menaceko
Profile Joined May 2012
United States58 Posts
June 29 2012 17:34 GMT
#131
On June 30 2012 02:12 Zorkmid wrote:
Keep your chin up man, don't worry about what the SoTG clique thinks, they're just smelling themselves.



Ain't that the truth... especially JP, he tries too hard to be apart of the 'clique' he's just an ugly mess really...



Avilo debated that well and IdrA thinks he's the king of the world as normal... he also called MarineKing shit LOL, he's had more success in both BW and SC2 than IdrA, he needs to quiet down sometimes.
BW: Nal_rA, JangBi, Grape, Stork, Brave, Bisu, mini, Horang2, BeSt, Movie, Jaehoon, Pusan, Kal, Shuttle, Reach, Anytime SC2: PartinG, Squirtle. HerO, NonY, MaNa, MC, HuK, SaSe, WhiteRa, Genius, Inori, Oz, ToD, JYP, KilleR(SangHo), VINES, TAiLS, NaNiwa
ErAsc2
Profile Joined May 2012
Sweden256 Posts
Last Edited: 2012-06-29 17:36:21
June 29 2012 17:35 GMT
#132
yo avilo, why don't you switch race to P or Z? If Terran is so weak, back it up by playing the other races as your main race or quit whining. Cause if you played Protoss, you'd whine that Zerg/Terran is OP. If you played Zerg, you'd whine that Terran/Protoss is OP.

I'm not trying to be rude or anything, but all your balance whining comes from blatantly obvious bias.
Swedish GM Protoss http://eu.battle.net/sc2/en/profile/2336142/1/MilkEA/
KiF1rE
Profile Blog Joined November 2009
United States964 Posts
June 29 2012 17:38 GMT
#133
On June 30 2012 02:35 ErAsc2 wrote:
yo avilo, why don't you switch race to P or Z? If Terran is so weak, back it up by playing the other races as your main race or quit whining. Cause if you played Protoss, you'd whine that Zerg/Terran is OP. If you played Zerg, you'd whine that Terran/Protoss is OP.

I'm not trying to be rude or anything, but all your balance whining comes from blatantly obvious bias.



you obviously havent watched his stream when he ladders as random....
Incognoto
Profile Blog Joined May 2010
France10239 Posts
June 29 2012 18:02 GMT
#134
I'm an Idra fan but I try to remain as objective as possible. Do you really think that Avilo's points were actually good? I watched the debate and all I could hear was Avilo saying "thanks to the Queen buff, Z can now drone to 80 drones and win with eco-heavy tech switches, T can't pressure Z without all-in'ing". To which I'm pretty sure I heard Idra respond "The old builds don't work anymore, Terrans need to find new pressure builds and it's already been done in Korea". Idra's ad hominem was that Avilo simply wasn't playing the match up correctly.

Evidently, Idra's terms were colorful than the ones I used, but that's basically how I read the debate. Believe me, I'm trying to be civil and objective here. I'm presenting my point of view on the matter and I'd be quite interested to hear what people here truly think when they say Avilo 1 - Idra 0. I don't have anything against Avilo, though I am a bit curious, that's all.
maru lover forever
Dalguno
Profile Blog Joined January 2011
United States2446 Posts
June 29 2012 18:09 GMT
#135
On June 30 2012 03:02 Incognoto wrote:
I'm an Idra fan but I try to remain as objective as possible. Do you really think that Avilo's points were actually good? I watched the debate and all I could hear was Avilo saying "thanks to the Queen buff, Z can now drone to 80 drones and win with eco-heavy tech switches, T can't pressure Z without all-in'ing". To which I'm pretty sure I heard Idra respond "The old builds don't work anymore, Terrans need to find new pressure builds and it's already been done in Korea". Idra's ad hominem was that Avilo simply wasn't playing the match up correctly.

Evidently, Idra's terms were colorful than the ones I used, but that's basically how I read the debate. Believe me, I'm trying to be civil and objective here. I'm presenting my point of view on the matter and I'd be quite interested to hear what people here truly think when they say Avilo 1 - Idra 0. I don't have anything against Avilo, though I am a bit curious, that's all.


I think they both argued poorly. Avilo was using what I hope are hyperboles to describe the way the matchup works now, and while Idra was logical in his points he attacked Avilo unfairly because of his points. It wasn't civil at all like the qxc and Idra discussion, but that's because that's what JP and crew wanted to happen it appears.
"I'm gonna keep making drones cause I'm a baller, and ballers make drones." -Snute
ErAsc2
Profile Joined May 2012
Sweden256 Posts
June 29 2012 18:26 GMT
#136
On June 30 2012 02:38 KiF1rE wrote:
Show nested quote +
On June 30 2012 02:35 ErAsc2 wrote:
yo avilo, why don't you switch race to P or Z? If Terran is so weak, back it up by playing the other races as your main race or quit whining. Cause if you played Protoss, you'd whine that Zerg/Terran is OP. If you played Zerg, you'd whine that Terran/Protoss is OP.

I'm not trying to be rude or anything, but all your balance whining comes from blatantly obvious bias.



you obviously havent watched his stream when he ladders as random....

More like, I haven't watched his stream- period... And if you re-read what I said, I said as his main race. I sometimes queue as random aswell for fun and win games with Terran and Zerg, that doesn't give me the right to whine about balance. If Avilo were to play T/P as his main race for a month, he'd call Terran OP, trust me.
Swedish GM Protoss http://eu.battle.net/sc2/en/profile/2336142/1/MilkEA/
_Skilgannon_
Profile Joined March 2012
15 Posts
June 29 2012 18:29 GMT
#137
On June 30 2012 03:02 Incognoto wrote:
I'm an Idra fan but I try to remain as objective as possible. Do you really think that Avilo's points were actually good? I watched the debate and all I could hear was Avilo saying "thanks to the Queen buff, Z can now drone to 80 drones and win with eco-heavy tech switches, T can't pressure Z without all-in'ing". To which I'm pretty sure I heard Idra respond "The old builds don't work anymore, Terrans need to find new pressure builds and it's already been done in Korea". Idra's ad hominem was that Avilo simply wasn't playing the match up correctly.

Evidently, Idra's terms were colorful than the ones I used, but that's basically how I read the debate. Believe me, I'm trying to be civil and objective here. I'm presenting my point of view on the matter and I'd be quite interested to hear what people here truly think when they say Avilo 1 - Idra 0. I don't have anything against Avilo, though I am a bit curious, that's all.


You're correct, I don't see how this argument polarized so quickly. I felt like IdrA was showing uncharacteristic optimism towards the options Terran had, while Avilo was arguing that it was imbalanced & without cure.
I think the meta-game will even itself out anyways. Whenever there is a buff to a race, that race always enjoys some a higher percentage while players adjust. I really doubt that some queens throwing their sewing needles a few meters farther is the end of the world.
CCsyph
Profile Joined May 2012
United Kingdom97 Posts
Last Edited: 2012-06-29 18:37:08
June 29 2012 18:35 GMT
#138
On June 30 2012 03:02 Incognoto wrote:
I'm an Idra fan but I try to remain as objective as possible. Do you really think that Avilo's points were actually good? I watched the debate and all I could hear was Avilo saying "thanks to the Queen buff, Z can now drone to 80 drones and win with eco-heavy tech switches, T can't pressure Z without all-in'ing". To which I'm pretty sure I heard Idra respond "The old builds don't work anymore, Terrans need to find new pressure builds and it's already been done in Korea". Idra's ad hominem was that Avilo simply wasn't playing the match up correctly.

Evidently, Idra's terms were colorful than the ones I used, but that's basically how I read the debate. Believe me, I'm trying to be civil and objective here. I'm presenting my point of view on the matter and I'd be quite interested to hear what people here truly think when they say Avilo 1 - Idra 0. I don't have anything against Avilo, though I am a bit curious, that's all.

The problem I find with the way everyone on SotG appears to debate is that they never give solid reasoning, it's all situational cases put forward to counter the bigger picture.

Things were said such as "If you can't go into the main, just sneak around" - by IdrA when questioned about Hellions. I don't even need to point out what the flaws are in saying things like this are but I will regardless. Maps are different, that much should be obvious, you can't just "sneak around" on every map, you can't just "go into the main" either. Of course there are very select cases on specific maps where you could do things like this, especially on maps like Entombed Valley or Ohana - anything with a wide ramp really. Usually when silly things like this are said, they are retorted with another situational resolution or counter to what was said, ultimately taking the debate nowhere and leaving everyone involved no closer to determining whether the match up is broken or not. I find this happens a lot in American - not restricted to StarCraft - debates but I'm in no such position to make such generalisations.

Avilo, admittedly, argued his side extremely poorly, making just as many situational arguments as IdrA rebutted with but what really makes this such an outcry is how he was treated. IdrA -- who is not doing very well at the moment, making the statement even more conceited than it usually would -- called him bad and told him to "shut the fuck up". When Avilo responded to these personal attacks he was cut off, mid sentence no less.

I personally don't believe the match-up is broken, I don't play the game anymore. I just watch, silently and excessively. I doubt that means anything, though.
"I hear you speak and suddenly I'm reminded of how the people I respected most in my life had a problem with authority."
eNbee
Profile Joined July 2010
Belgium487 Posts
June 29 2012 18:37 GMT
#139
On June 30 2012 03:29 _Skilgannon_ wrote:
I felt like IdrA was showing uncharacteristic optimism towards the options Terran had.



I wouldn't call it uncharacteristic, the current state of the game isn't negative towards zerg, that's the difference.

In the end IdrA definitely came out looking bad as far as I'm concerned, I felt like he wasn't even listening to Avilo, because he deems him to be an inferior player, which is debatable, IdrA isn't anywhere near a top player at the moment, he should really tone that down.

Also calling Marineking bad and saying he doesn't know what he was doing -> that made IdrA look like an idiot before this "debate" even started :/
hmmmm
CCsyph
Profile Joined May 2012
United Kingdom97 Posts
June 29 2012 18:44 GMT
#140
On June 30 2012 03:26 ErAsc2 wrote:
Show nested quote +
On June 30 2012 02:38 KiF1rE wrote:
On June 30 2012 02:35 ErAsc2 wrote:
yo avilo, why don't you switch race to P or Z? If Terran is so weak, back it up by playing the other races as your main race or quit whining. Cause if you played Protoss, you'd whine that Zerg/Terran is OP. If you played Zerg, you'd whine that Terran/Protoss is OP.

I'm not trying to be rude or anything, but all your balance whining comes from blatantly obvious bias.



you obviously havent watched his stream when he ladders as random....

More like, I haven't watched his stream- period... And if you re-read what I said, I said as his main race. I sometimes queue as random aswell for fun and win games with Terran and Zerg, that doesn't give me the right to whine about balance. If Avilo were to play T/P as his main race for a month, he'd call Terran OP, trust me.


Keep such idiotic statements out of his fan club.
"I hear you speak and suddenly I'm reminded of how the people I respected most in my life had a problem with authority."
Starshaped
Profile Blog Joined December 2009
Sweden575 Posts
June 29 2012 18:45 GMT
#141
On June 30 2012 03:02 Incognoto wrote:
I'm an Idra fan but I try to remain as objective as possible. Do you really think that Avilo's points were actually good? I watched the debate and all I could hear was Avilo saying "thanks to the Queen buff, Z can now drone to 80 drones and win with eco-heavy tech switches, T can't pressure Z without all-in'ing". To which I'm pretty sure I heard Idra respond "The old builds don't work anymore, Terrans need to find new pressure builds and it's already been done in Korea". Idra's ad hominem was that Avilo simply wasn't playing the match up correctly.

Evidently, Idra's terms were colorful than the ones I used, but that's basically how I read the debate. Believe me, I'm trying to be civil and objective here. I'm presenting my point of view on the matter and I'd be quite interested to hear what people here truly think when they say Avilo 1 - Idra 0. I don't have anything against Avilo, though I am a bit curious, that's all.


Idra is a complete moron, saying things like "go fast 3cc and put on pressure at the same time" and basically saying that Terran can keep up with Zerg techswitches, which is just bullshit.

Avilo made some great points, like how Terran needs to make the PERFECT army composition based on what he sees to survive, and once the fight is over there's no way of knowing if it's gonna be followed up by 200 food ground or 200 food air. Meanwhile Zerg doesn't have to even consider what his opponent has, because infestors are alway good, broodlords are always good etc. etc. And since Terran needs actual buildings to produce units there's no way to have the tech-switch capabilities that Zerg does, not to mention the Terran bank will always be a lot smaller.

And yeah, Idra calling anyone terrible is just hilarious. Talk about throwing rocks in glass houses. I lost what little respect I had for Idra after that 'debate'. He's so clueless, terrible, and bad mannered. If only his fame-to-skill ratio wasn't so skewed he would be long gone and forgotten by now.
My Starcraft 2, gaming and e-sports-related blog: http://starshapedthoughts.blogspot.com/
CCsyph
Profile Joined May 2012
United Kingdom97 Posts
June 29 2012 18:52 GMT
#142
On June 30 2012 03:45 Starshaped wrote:
Show nested quote +
On June 30 2012 03:02 Incognoto wrote:
I'm an Idra fan but I try to remain as objective as possible. Do you really think that Avilo's points were actually good? I watched the debate and all I could hear was Avilo saying "thanks to the Queen buff, Z can now drone to 80 drones and win with eco-heavy tech switches, T can't pressure Z without all-in'ing". To which I'm pretty sure I heard Idra respond "The old builds don't work anymore, Terrans need to find new pressure builds and it's already been done in Korea". Idra's ad hominem was that Avilo simply wasn't playing the match up correctly.

Evidently, Idra's terms were colorful than the ones I used, but that's basically how I read the debate. Believe me, I'm trying to be civil and objective here. I'm presenting my point of view on the matter and I'd be quite interested to hear what people here truly think when they say Avilo 1 - Idra 0. I don't have anything against Avilo, though I am a bit curious, that's all.


Idra is a complete moron, saying things like "go fast 3cc and put on pressure at the same time" and basically saying that Terran can keep up with Zerg techswitches, which is just bullshit.

Avilo made some great points, like how Terran needs to make the PERFECT army composition based on what he sees to survive, and once the fight is over there's no way of knowing if it's gonna be followed up by 200 food ground or 200 food air. Meanwhile Zerg doesn't have to even consider what his opponent has, because infestors are alway good, broodlords are always good etc. etc. And since Terran needs actual buildings to produce units there's no way to have the tech-switch capabilities that Zerg does, not to mention the Terran bank will always be a lot smaller.

And yeah, Idra calling anyone terrible is just hilarious. Talk about throwing rocks in glass houses. I lost what little respect I had for Idra after that 'debate'. He's so clueless, terrible, and bad mannered. If only his fame-to-skill ratio wasn't so skewed he would be long gone and forgotten by now.


I'd say that fame to skill ratio skewering goes for every professional player on there.
+ Show Spoiler +
NonY is a bro, though.

"I hear you speak and suddenly I'm reminded of how the people I respected most in my life had a problem with authority."
indxrje
Profile Joined May 2012
227 Posts
June 29 2012 18:56 GMT
#143
i don't follow state of the retards does anyone have a link to the vod with avilo on?

User was temp banned for this post.
hihi
CCsyph
Profile Joined May 2012
United Kingdom97 Posts
June 29 2012 18:59 GMT
#144
On June 30 2012 03:56 indxrje wrote:
i don't follow state of the retards does anyone have a link to the vod with avilo on?



There
"I hear you speak and suddenly I'm reminded of how the people I respected most in my life had a problem with authority."
indxrje
Profile Joined May 2012
227 Posts
June 29 2012 19:05 GMT
#145
thx bro
hihi
saMas
Profile Joined July 2011
Belgium37 Posts
June 29 2012 19:06 GMT
#146
wooow I just lost allot of respect for the people on SOTG.Avilo was being mannerd and idra just reacts like a litle spoiled kid, this is getting kinda sad.
Shoggoth
Profile Joined February 2011
England75 Posts
June 29 2012 19:17 GMT
#147
On June 30 2012 04:06 saMas wrote:
wooow I just lost allot of respect for the people on SOTG.Avilo was being mannerd and idra just reacts like a litle spoiled kid, this is getting kinda sad.


He does it because he gets away with it.
Fiend of a thousand faces
D4V3Z02
Profile Joined April 2011
Germany693 Posts
Last Edited: 2012-06-29 20:10:28
June 29 2012 20:04 GMT
#148
On June 30 2012 04:06 saMas wrote:
wooow I just lost allot of respect for the people on SOTG.Avilo was being mannerd and idra just reacts like a litle spoiled kid, this is getting kinda sad.


Interrupting Idra several times was bad mannered, also his points were random thougths "oh hey did u see fitzyhares build?". Idras arguments were just ten times better and Avilo stood at his points pretty arrogant, thats why he had to leave. Also they seemed to know that Avilo is that naiv and they invited him as a trol, it was just about making idra mad for the viewers.

User was temp banned for this post.
http://www.twitch.tv/d4v3z02 all your base are belong to overlord
CCsyph
Profile Joined May 2012
United Kingdom97 Posts
June 29 2012 20:35 GMT
#149
On June 30 2012 05:04 D4V3Z02 wrote:
Show nested quote +
On June 30 2012 04:06 saMas wrote:
wooow I just lost allot of respect for the people on SOTG.Avilo was being mannerd and idra just reacts like a litle spoiled kid, this is getting kinda sad.


Interrupting Idra several times was bad mannered, also his points were random thougths "oh hey did u see fitzyhares build?". Idras arguments were just ten times better and Avilo stood at his points pretty arrogant, thats why he had to leave. Also they seemed to know that Avilo is that naiv and they invited him as a trol, it was just about making idra mad for the viewers.

Keep your idiocy out of his fan club.

Try making your sentences coherent then people will take your nonsensical, defamatory opinions seriously.
"I hear you speak and suddenly I'm reminded of how the people I respected most in my life had a problem with authority."
Waterflow
Profile Joined May 2011
Sweden1550 Posts
June 29 2012 20:36 GMT
#150
This guy has balls!
Kfcnoob
Profile Joined January 2011
United States296 Posts
June 29 2012 21:48 GMT
#151
On June 30 2012 05:35 CCsyph wrote:
Show nested quote +
On June 30 2012 05:04 D4V3Z02 wrote:
On June 30 2012 04:06 saMas wrote:
wooow I just lost allot of respect for the people on SOTG.Avilo was being mannerd and idra just reacts like a litle spoiled kid, this is getting kinda sad.


Interrupting Idra several times was bad mannered, also his points were random thougths "oh hey did u see fitzyhares build?". Idras arguments were just ten times better and Avilo stood at his points pretty arrogant, thats why he had to leave. Also they seemed to know that Avilo is that naiv and they invited him as a trol, it was just about making idra mad for the viewers.

Keep your idiocy out of his fan club.

Try making your sentences coherent then people will take your nonsensical, defamatory opinions seriously.



there is nothing incomprehensible about D4V3Z02's post. There are two sides to any argument, and understanding both sides is a much stronger approach than unshakeable fanboyism.
And Artosis sayeth "the one who kills many, but loses few, comes out ahead."
CCsyph
Profile Joined May 2012
United Kingdom97 Posts
Last Edited: 2012-06-29 21:58:23
June 29 2012 21:56 GMT
#152
On June 30 2012 06:48 Kfcnoob wrote:
Show nested quote +
On June 30 2012 05:35 CCsyph wrote:
On June 30 2012 05:04 D4V3Z02 wrote:
On June 30 2012 04:06 saMas wrote:
wooow I just lost allot of respect for the people on SOTG.Avilo was being mannerd and idra just reacts like a litle spoiled kid, this is getting kinda sad.


Interrupting Idra several times was bad mannered, also his points were random thougths "oh hey did u see fitzyhares build?". Idras arguments were just ten times better and Avilo stood at his points pretty arrogant, thats why he had to leave. Also they seemed to know that Avilo is that naiv and they invited him as a trol, it was just about making idra mad for the viewers.

Keep your idiocy out of his fan club.

Try making your sentences coherent then people will take your nonsensical, defamatory opinions seriously.



there is nothing incomprehensible about D4V3Z02's post. There are two sides to any argument, and understanding both sides is a much stronger approach than unshakeable fanboyism.

Did you not read what he said? Words misspelled, little punctuation, misnaming a player and incoherent sentence structure to name but a few.

Not to mention your little grasp of grammar, you do not put the word 'and' after a comma. I am not a fanboy of Avilo, this is the first time I have heard of him, making your point invalid.

You do not post hatred towards that player, in his/her fanclub.

EDIT: I didn't even say "incomprehensible" in my original post.
"I hear you speak and suddenly I'm reminded of how the people I respected most in my life had a problem with authority."
Keidy
Profile Joined June 2009
253 Posts
June 29 2012 22:02 GMT
#153
Wouldnt worry about Idra nor his fanboys. They are like the Justin Bieber fans tbh.
Makes alot of sound and they are everywere but nothing good ever comes out of them. Just loud and irratating noices.

Idra have been, and always will be a crybaby. He is a nobody and I wouldnt even consider taking anything he says serious.

Sotg is just a club for internal admiration, Avilo should just stay away
Corsica
Profile Joined February 2011
Ukraine1854 Posts
June 29 2012 22:08 GMT
#154
On June 30 2012 04:17 Shoggoth wrote:
Show nested quote +
On June 30 2012 04:06 saMas wrote:
wooow I just lost allot of respect for the people on SOTG.Avilo was being mannerd and idra just reacts like a litle spoiled kid, this is getting kinda sad.


He does it because he gets away with it.



because he is JP friend... Sad that Tyler or Qxc didnt go against jp...
EsMuyVien
Profile Joined July 2011
United States408 Posts
Last Edited: 2012-06-29 22:17:22
June 29 2012 22:12 GMT
#155
On June 30 2012 07:02 Keidy wrote:
Wouldnt worry about Idra nor his fanboys. They are like the Justin Bieber fans tbh.
Makes alot of sound and they are everywere but nothing good ever comes out of them. Just loud and irratating noices.

Idra have been, and always will be a crybaby. He is a nobody and I wouldnt even consider taking anything he says serious.

Sotg is just a club for internal admiration, Avilo should just stay away


Calling others crybabies while lauding Avilo... I'm pretty indifferent to Avilo, though i like his fun play, but that just makes no sense. He's even worse than IdrA at imbalance whining - if you paid attention to him at all before this you would know that.
If what I think is happening is happening - it better not be.
mrtomjones
Profile Joined April 2011
Canada4020 Posts
June 30 2012 00:26 GMT
#156
On June 30 2012 06:56 CCsyph wrote:
Show nested quote +
On June 30 2012 06:48 Kfcnoob wrote:
On June 30 2012 05:35 CCsyph wrote:
On June 30 2012 05:04 D4V3Z02 wrote:
On June 30 2012 04:06 saMas wrote:
wooow I just lost allot of respect for the people on SOTG.Avilo was being mannerd and idra just reacts like a litle spoiled kid, this is getting kinda sad.


Interrupting Idra several times was bad mannered, also his points were random thougths "oh hey did u see fitzyhares build?". Idras arguments were just ten times better and Avilo stood at his points pretty arrogant, thats why he had to leave. Also they seemed to know that Avilo is that naiv and they invited him as a trol, it was just about making idra mad for the viewers.

Keep your idiocy out of his fan club.

Try making your sentences coherent then people will take your nonsensical, defamatory opinions seriously.



there is nothing incomprehensible about D4V3Z02's post. There are two sides to any argument, and understanding both sides is a much stronger approach than unshakeable fanboyism.

Did you not read what he said? Words misspelled, little punctuation, misnaming a player and incoherent sentence structure to name but a few.

Not to mention your little grasp of grammar, you do not put the word 'and' after a comma. I am not a fanboy of Avilo, this is the first time I have heard of him, making your point invalid.

You do not post hatred towards that player, in his/her fanclub.

EDIT: I didn't even say "incomprehensible" in my original post.

Oh no! Not punctuation problems! His post was completely understandable and had good points. Idra went overboard but Avillo was poking him. He was put on the program to piss Idra off though.
CCsyph
Profile Joined May 2012
United Kingdom97 Posts
June 30 2012 01:57 GMT
#157
On June 30 2012 09:26 mrtomjones wrote:
Show nested quote +
On June 30 2012 06:56 CCsyph wrote:
On June 30 2012 06:48 Kfcnoob wrote:
On June 30 2012 05:35 CCsyph wrote:
On June 30 2012 05:04 D4V3Z02 wrote:
On June 30 2012 04:06 saMas wrote:
wooow I just lost allot of respect for the people on SOTG.Avilo was being mannerd and idra just reacts like a litle spoiled kid, this is getting kinda sad.


Interrupting Idra several times was bad mannered, also his points were random thougths "oh hey did u see fitzyhares build?". Idras arguments were just ten times better and Avilo stood at his points pretty arrogant, thats why he had to leave. Also they seemed to know that Avilo is that naiv and they invited him as a trol, it was just about making idra mad for the viewers.

Keep your idiocy out of his fan club.

Try making your sentences coherent then people will take your nonsensical, defamatory opinions seriously.



there is nothing incomprehensible about D4V3Z02's post. There are two sides to any argument, and understanding both sides is a much stronger approach than unshakeable fanboyism.

Did you not read what he said? Words misspelled, little punctuation, misnaming a player and incoherent sentence structure to name but a few.

Not to mention your little grasp of grammar, you do not put the word 'and' after a comma. I am not a fanboy of Avilo, this is the first time I have heard of him, making your point invalid.

You do not post hatred towards that player, in his/her fanclub.

EDIT: I didn't even say "incomprehensible" in my original post.

Oh no! Not punctuation problems! His post was completely understandable and had good points. Idra went overboard but Avillo was poking him. He was put on the program to piss Idra off though.

Notice how this is the Avilo fan club and not the "IdrA was right and Avilo was wrong" thread.
"I hear you speak and suddenly I'm reminded of how the people I respected most in my life had a problem with authority."
hinnolinn
Profile Joined August 2010
212 Posts
Last Edited: 2012-06-30 02:08:09
June 30 2012 02:07 GMT
#158
On June 30 2012 06:56 CCsyph wrote:
Show nested quote +
On June 30 2012 06:48 Kfcnoob wrote:
On June 30 2012 05:35 CCsyph wrote:
On June 30 2012 05:04 D4V3Z02 wrote:
On June 30 2012 04:06 saMas wrote:
wooow I just lost allot of respect for the people on SOTG.Avilo was being mannerd and idra just reacts like a litle spoiled kid, this is getting kinda sad.


Interrupting Idra several times was bad mannered, also his points were random thougths "oh hey did u see fitzyhares build?". Idras arguments were just ten times better and Avilo stood at his points pretty arrogant, thats why he had to leave. Also they seemed to know that Avilo is that naiv and they invited him as a trol, it was just about making idra mad for the viewers.

Keep your idiocy out of his fan club.

Try making your sentences coherent then people will take your nonsensical, defamatory opinions seriously.



there is nothing incomprehensible about D4V3Z02's post. There are two sides to any argument, and understanding both sides is a much stronger approach than unshakeable fanboyism.

Did you not read what he said? Words misspelled, little punctuation, misnaming a player and incoherent sentence structure to name but a few.

Not to mention your little grasp of grammar, you do not put the word 'and' after a comma. I am not a fanboy of Avilo, this is the first time I have heard of him, making your point invalid.

You do not post hatred towards that player, in his/her fanclub.

EDIT: I didn't even say "incomprehensible" in my original post.


http://www.grammarbook.com/punctuation/commas.asp
I'm guessing rule 12 or 13 covers his grammar there, but, of course, insulting him sounds better.
Zenbrez
Profile Joined June 2012
Canada5973 Posts
Last Edited: 2012-06-30 02:18:59
June 30 2012 02:12 GMT
#159
On June 30 2012 07:08 Corsica wrote:
Show nested quote +
On June 30 2012 04:17 Shoggoth wrote:
On June 30 2012 04:06 saMas wrote:
wooow I just lost allot of respect for the people on SOTG.Avilo was being mannerd and idra just reacts like a litle spoiled kid, this is getting kinda sad.


He does it because he gets away with it.



because he is JP friend... Sad that Tyler or Qxc didnt go against jp...

Didn't one of them say to not bring him on because it gives him attention? I don't remember who said it, but it may have even been Greg.
Refer to my post.
The WingNut
Profile Joined February 2012
United States35 Posts
June 30 2012 02:27 GMT
#160
Sign me up for this fan club!
HeathenHill
Profile Joined January 2012
Australia22 Posts
Last Edited: 2012-06-30 04:51:39
June 30 2012 04:47 GMT
#161
Avilo! F**k all the haters dude, keep doing your thing, that behaviour shown on SOTG was an absolute joke. Look forward to more streams and hopefully some results in the future for you.

All the best.
.Are we not the undisputed prodigy of warfare.
gosublade
Profile Joined May 2011
632 Posts
June 30 2012 10:18 GMT
#162
you want attention avilo? here you go.., hi
Not even death can save you from me.
Incognoto
Profile Blog Joined May 2010
France10239 Posts
Last Edited: 2012-06-30 11:10:29
June 30 2012 10:59 GMT
#163
On June 30 2012 03:45 Starshaped wrote:
Show nested quote +
On June 30 2012 03:02 Incognoto wrote:
I'm an Idra fan but I try to remain as objective as possible. Do you really think that Avilo's points were actually good? I watched the debate and all I could hear was Avilo saying "thanks to the Queen buff, Z can now drone to 80 drones and win with eco-heavy tech switches, T can't pressure Z without all-in'ing". To which I'm pretty sure I heard Idra respond "The old builds don't work anymore, Terrans need to find new pressure builds and it's already been done in Korea". Idra's ad hominem was that Avilo simply wasn't playing the match up correctly.

Evidently, Idra's terms were colorful than the ones I used, but that's basically how I read the debate. Believe me, I'm trying to be civil and objective here. I'm presenting my point of view on the matter and I'd be quite interested to hear what people here truly think when they say Avilo 1 - Idra 0. I don't have anything against Avilo, though I am a bit curious, that's all.


Idra is a complete moron, saying things like "go fast 3cc and put on pressure at the same time" and basically saying that Terran can keep up with Zerg techswitches, which is just bullshit.

Avilo made some great points, like how Terran needs to make the PERFECT army composition based on what he sees to survive, and once the fight is over there's no way of knowing if it's gonna be followed up by 200 food ground or 200 food air. Meanwhile Zerg doesn't have to even consider what his opponent has, because infestors are alway good, broodlords are always good etc. etc. And since Terran needs actual buildings to produce units there's no way to have the tech-switch capabilities that Zerg does, not to mention the Terran bank will always be a lot smaller.

And yeah, Idra calling anyone terrible is just hilarious. Talk about throwing rocks in glass houses. I lost what little respect I had for Idra after that 'debate'. He's so clueless, terrible, and bad mannered. If only his fame-to-skill ratio wasn't so skewed he would be long gone and forgotten by now.


You need to be careful, you seem really biased here. Idra is far from a complete moron and actually has an excellent understanding of the game. His last run at MLG wasn't as good as Orlando's or anything but he's far, very far, from incompetent. His results are comparable to many good foreigners so please don't call IdrA terrible just because he isn't dominating the scene in the one-sided manner he used to. He also isn't really bad mannered.. I'm pretty sure that he had a very civil discussion with Qxc. But I'm not here to talk about Idra.

Now, I'm not really going into a balance discussion because that isn't my place nor do I have the understand pros do. But you seem to think that TvZ late game is broken in Z's favor here, just because of tech switches and/or economy. I don't believe that that's the case. I also don't believe that T has 0 ways of pressuring Z at all. Queens are good but only defensively. A good Z needs to know when to drone and when to make units. A good T knows exactly how "greedy" he can play. etc


Ok, my point here is that I don't think the people on Sotg are assholes at all and I think that some people should really try to see the other point of view.

This may be useful for taking things into perspective: http://www.teamliquid.net/forum/viewmessage.php?topic_id=349154
maru lover forever
bLah.
Profile Joined July 2009
Croatia497 Posts
June 30 2012 12:14 GMT
#164
On June 30 2012 19:59 Incognoto wrote:
You need to be careful, you seem really biased here. Idra is far from a complete moron and actually has an excellent understanding of the game. His last run at MLG wasn't as good as Orlando's or anything but he's far, very far, from incompetent. His results are comparable to many good foreigners so please don't call IdrA terrible just because he isn't dominating the scene in the one-sided manner he used to. He also isn't really bad mannered.. I'm pretty sure that he had a very civil discussion with Qxc. But I'm not here to talk about Idra.


idra never dominated the scene, and his "understanding of the game" is pretty different from what he shows everywhere, and that's whining. He didnt' have civil discussion with QXC. Idra had his "I'm completely right and telling you what to do" attitude in that conversation but QXC decided not to get pulled into that, while Avilo said what every terran meant and got "STFU".

it was stupid to get avilo into the show and then just diss him the whey they did. It was specifically stupid that it was guy who had show named "imbalanced" who dissed him.

but after all this incident I'm pretty sure avilo got more fans than others others on that show, so there's that
Leberwurstbrot
Profile Joined March 2012
Germany144 Posts
June 30 2012 13:09 GMT
#165
On June 30 2012 21:14 bLah. wrote:
Show nested quote +
On June 30 2012 19:59 Incognoto wrote:
You need to be careful, you seem really biased here. Idra is far from a complete moron and actually has an excellent understanding of the game. His last run at MLG wasn't as good as Orlando's or anything but he's far, very far, from incompetent. His results are comparable to many good foreigners so please don't call IdrA terrible just because he isn't dominating the scene in the one-sided manner he used to. He also isn't really bad mannered.. I'm pretty sure that he had a very civil discussion with Qxc. But I'm not here to talk about Idra.


idra never dominated the scene, and his "understanding of the game" is pretty different from what he shows everywhere, and that's whining. He didnt' have civil discussion with QXC. Idra had his "I'm completely right and telling you what to do" attitude in that conversation but QXC decided not to get pulled into that, while Avilo said what every terran meant and got "STFU".

it was stupid to get avilo into the show and then just diss him the whey they did. It was specifically stupid that it was guy who had show named "imbalanced" who dissed him.

but after all this incident I'm pretty sure avilo got more fans than others others on that show, so there's that


Yeah, maybe that what every Terran thinks is false..? IdrA tried to tell him but Avilo is just kinda stupid and can not understand what IdrA was saying. He said only the same shit, IdrA reacted completly right.
bLah.
Profile Joined July 2009
Croatia497 Posts
June 30 2012 13:49 GMT
#166
On June 30 2012 22:09 Leberwurstbrot wrote:
Yeah, maybe that what every Terran thinks is false..? IdrA tried to tell him but Avilo is just kinda stupid and can not understand what IdrA was saying. He said only the same shit, IdrA reacted completly right.


It's probably true that every terran is false and that a guy who has saying "zerg isn't supposed to beat protoss" is completely right when he talks about balance and when he talks about how some race should just start playing better.

who knows
gosublade
Profile Joined May 2011
632 Posts
June 30 2012 14:26 GMT
#167
On June 30 2012 22:49 bLah. wrote:
Show nested quote +
On June 30 2012 22:09 Leberwurstbrot wrote:
Yeah, maybe that what every Terran thinks is false..? IdrA tried to tell him but Avilo is just kinda stupid and can not understand what IdrA was saying. He said only the same shit, IdrA reacted completly right.


It's probably true that every terran is false and that a guy who has saying "zerg isn't supposed to beat protoss" is completely right when he talks about balance and when he talks about how some race should just start playing better.

who knows


that quote is like a year old, your argument is invalid
Not even death can save you from me.
bLah.
Profile Joined July 2009
Croatia497 Posts
June 30 2012 14:52 GMT
#168
On June 30 2012 23:26 gosublade wrote:
that quote is like a year old, your argument is invalid


True, we've since seen how idra transformed into rational person who doesn't call people imbeciles when they don't agree with his whining opinions. ou wait, he called avilo just that in this show. Only difference why Idra can't whine like a bitch about current state of game is because Zerg is heavily favored everywhere so he's all like "T and P needs to adapt" which in current situation is basically the same.
Incognoto
Profile Blog Joined May 2010
France10239 Posts
June 30 2012 15:32 GMT
#169
On June 30 2012 21:14 bLah. wrote:
Show nested quote +
On June 30 2012 19:59 Incognoto wrote:
You need to be careful, you seem really biased here. Idra is far from a complete moron and actually has an excellent understanding of the game. His last run at MLG wasn't as good as Orlando's or anything but he's far, very far, from incompetent. His results are comparable to many good foreigners so please don't call IdrA terrible just because he isn't dominating the scene in the one-sided manner he used to. He also isn't really bad mannered.. I'm pretty sure that he had a very civil discussion with Qxc. But I'm not here to talk about Idra.


idra never dominated the scene, and his "understanding of the game" is pretty different from what he shows everywhere, and that's whining. He didnt' have civil discussion with QXC. Idra had his "I'm completely right and telling you what to do" attitude in that conversation but QXC decided not to get pulled into that, while Avilo said what every terran meant and got "STFU".

it was stupid to get avilo into the show and then just diss him the whey they did. It was specifically stupid that it was guy who had show named "imbalanced" who dissed him.

but after all this incident I'm pretty sure avilo got more fans than others others on that show, so there's that


This post is overflowing with bias and ignorance. I'm not going to defend Idra here because that's not what the point of the discussion is, though mind you nearly everything you say makes me want to scream and cry and correct everything with a latte of swear words to go along with it.

Basically, if you're defending what avilo said, you're defending that TvZ is completely and utterly broken. The other side of the argument is that if Zerg plays greedy, then Terrans can also play greedy. The trick is to play greedy by the right amount, which is something Terrans need to figure out. The other thing to note is that after a patch the metagame always changes, even slightly. So T builds also need to adapt to heavy Queen defense. It's not impossible either, as avilo stated. There are economic 2 rax openings which can make a Z uncomfortable. There are pre-hive timings that can work quite well for T if T sees multiple queens out. As long as you make minimal defenses early and get your 3rd up quickly enough, a strong timing is quite possible.

Neither was avilo invited to the show just to be dissed. Things only escalated when avilo tried to interrupt IdrA. Idra being Idra, he didn't take it so well. Which is genuinely understandable if you're debating with someone you don't want to and that person both interrupts and refuses to heed someone else's point of view. That's all really. It's not really that big a deal and you don't have to hate people on Sotg for it.
maru lover forever
bLah.
Profile Joined July 2009
Croatia497 Posts
Last Edited: 2012-06-30 15:47:42
June 30 2012 15:45 GMT
#170
On July 01 2012 00:32 Incognoto wrote:
Show nested quote +
On June 30 2012 21:14 bLah. wrote:
idra never dominated the scene, and his "understanding of the game" is pretty different from what he shows everywhere, and that's whining. He didnt' have civil discussion with QXC. Idra had his "I'm completely right and telling you what to do" attitude in that conversation but QXC decided not to get pulled into that, while Avilo said what every terran meant and got "STFU".

it was stupid to get avilo into the show and then just diss him the whey they did. It was specifically stupid that it was guy who had show named "imbalanced" who dissed him.

but after all this incident I'm pretty sure avilo got more fans than others others on that show, so there's that


This post is overflowing with bias and ignorance. I'm not going to defend Idra here because that's not what the point of the discussion is, though mind you nearly everything you say makes me want to scream and cry and correct everything with a latte of swear words to go along with it.

Basically, if you're defending what avilo said, you're defending that TvZ is completely and utterly broken. The other side of the argument is that if Zerg plays greedy, then Terrans can also play greedy. The trick is to play greedy by the right amount, which is something Terrans need to figure out. The other thing to note is that after a patch the metagame always changes, even slightly. So T builds also need to adapt to heavy Queen defense. It's not impossible either, as avilo stated. There are economic 2 rax openings which can make a Z uncomfortable. There are pre-hive timings that can work quite well for T if T sees multiple queens out. As long as you make minimal defenses early and get your 3rd up quickly enough, a strong timing is quite possible.

Neither was avilo invited to the show just to be dissed. Things only escalated when avilo tried to interrupt IdrA. Idra being Idra, he didn't take it so well. Which is genuinely understandable if you're debating with someone you don't want to and that person both interrupts and refuses to heed someone else's point of view. That's all really. It's not really that big a deal and you don't have to hate people on Sotg for it.


Actually I didn't say anywhere that I agree with avilo's points or with him whatsoever. I said that "idra being idra" shouldn't be acceptable behaviour and that dissing someone, telling them they're imbeciles and to stfu is NOT and shouldn't be "genuinely understandable" ever.
I said that if there's a big discussion in a community like it is now with TvZ then there can't be anyone who will just sit on some high throne and talk about balance and gameplay like it's some done deal. Idra is all like "let's see how it works like", and then when someone doesn't agree with some actual points he starts with "imbecile, stfu, etc." which is funny considering his whining past.

I actually don't have anything against Idra, I just think he's the worst guy to have ono a show to talk about balance because other people handle those subject so much better and are more informative about it.

And this is my last post here because it's fanclub, not discussion about idra, just wanted to say that it's completely true that Avilo (who I don't usually care that much about) was being dissed completely on top of usual making fun of through past 2 episodes.
Incognoto
Profile Blog Joined May 2010
France10239 Posts
June 30 2012 16:32 GMT
#171
On July 01 2012 00:45 bLah. wrote:
Show nested quote +
On July 01 2012 00:32 Incognoto wrote:
On June 30 2012 21:14 bLah. wrote:
idra never dominated the scene, and his "understanding of the game" is pretty different from what he shows everywhere, and that's whining. He didnt' have civil discussion with QXC. Idra had his "I'm completely right and telling you what to do" attitude in that conversation but QXC decided not to get pulled into that, while Avilo said what every terran meant and got "STFU".

it was stupid to get avilo into the show and then just diss him the whey they did. It was specifically stupid that it was guy who had show named "imbalanced" who dissed him.

but after all this incident I'm pretty sure avilo got more fans than others others on that show, so there's that


This post is overflowing with bias and ignorance. I'm not going to defend Idra here because that's not what the point of the discussion is, though mind you nearly everything you say makes me want to scream and cry and correct everything with a latte of swear words to go along with it.

Basically, if you're defending what avilo said, you're defending that TvZ is completely and utterly broken. The other side of the argument is that if Zerg plays greedy, then Terrans can also play greedy. The trick is to play greedy by the right amount, which is something Terrans need to figure out. The other thing to note is that after a patch the metagame always changes, even slightly. So T builds also need to adapt to heavy Queen defense. It's not impossible either, as avilo stated. There are economic 2 rax openings which can make a Z uncomfortable. There are pre-hive timings that can work quite well for T if T sees multiple queens out. As long as you make minimal defenses early and get your 3rd up quickly enough, a strong timing is quite possible.

Neither was avilo invited to the show just to be dissed. Things only escalated when avilo tried to interrupt IdrA. Idra being Idra, he didn't take it so well. Which is genuinely understandable if you're debating with someone you don't want to and that person both interrupts and refuses to heed someone else's point of view. That's all really. It's not really that big a deal and you don't have to hate people on Sotg for it.


Actually I didn't say anywhere that I agree with avilo's points or with him whatsoever. I said that "idra being idra" shouldn't be acceptable behaviour and that dissing someone, telling them they're imbeciles and to stfu is NOT and shouldn't be "genuinely understandable" ever.
I said that if there's a big discussion in a community like it is now with TvZ then there can't be anyone who will just sit on some high throne and talk about balance and gameplay like it's some done deal. Idra is all like "let's see how it works like", and then when someone doesn't agree with some actual points he starts with "imbecile, stfu, etc." which is funny considering his whining past.

I actually don't have anything against Idra, I just think he's the worst guy to have ono a show to talk about balance because other people handle those subject so much better and are more informative about it.

And this is my last post here because it's fanclub, not discussion about idra, just wanted to say that it's completely true that Avilo (who I don't usually care that much about) was being dissed completely on top of usual making fun of through past 2 episodes.


This is reminding me of the Destiny thing we had a while ago. Idra didn't start saying stfu when avilo was disagreeing with him. He said stfu when avilo was interrupting him. He didn't flame Qxc who didn't agree with him either. Idra being Idra is being impatient, Idra being Idra isn't being nasty to avilo because he disagrees with him. Avilo interrupted Idra in the middle of his point which is tediously annoying when you're repeating something to someone who clearly isn't listening or giving ground.

I actually find Idra and Destiny to both be my two biggest sources on Zerg. If you take the time to listen to what they say and try to think about what they then you see it makes sense. You can see their points in examples in the game. You can also consider that even if Idra hasn't placed first in recent tournaments doesn't mean that he doesn't know shit about the game. So I actually think he has the right to think he knows best. Because he probably does.. unfortunately some people just can't see that or refuse to try to see it.

I'm going to stop here because this isn't really going anywhere, I hope that at least a few people have read this discussion and at least thought a bit about everything.. gl hf
maru lover forever
Irave
Profile Joined October 2010
United States9965 Posts
June 30 2012 16:55 GMT
#172
Sign me up.
Waterflow
Profile Joined May 2011
Sweden1550 Posts
June 30 2012 17:05 GMT
#173
On June 30 2012 22:09 Leberwurstbrot wrote:
Show nested quote +
On June 30 2012 21:14 bLah. wrote:
On June 30 2012 19:59 Incognoto wrote:
You need to be careful, you seem really biased here. Idra is far from a complete moron and actually has an excellent understanding of the game. His last run at MLG wasn't as good as Orlando's or anything but he's far, very far, from incompetent. His results are comparable to many good foreigners so please don't call IdrA terrible just because he isn't dominating the scene in the one-sided manner he used to. He also isn't really bad mannered.. I'm pretty sure that he had a very civil discussion with Qxc. But I'm not here to talk about Idra.


idra never dominated the scene, and his "understanding of the game" is pretty different from what he shows everywhere, and that's whining. He didnt' have civil discussion with QXC. Idra had his "I'm completely right and telling you what to do" attitude in that conversation but QXC decided not to get pulled into that, while Avilo said what every terran meant and got "STFU".

it was stupid to get avilo into the show and then just diss him the whey they did. It was specifically stupid that it was guy who had show named "imbalanced" who dissed him.

but after all this incident I'm pretty sure avilo got more fans than others others on that show, so there's that


Yeah, maybe that what every Terran thinks is false..? IdrA tried to tell him but Avilo is just kinda stupid and can not understand what IdrA was saying. He said only the same shit, IdrA reacted completly right.


Acted completely right by saying "Shut the fuck up"?

He could of just said "Don't interrupt me" but chose the immature way of dealing with it instead. IdrA has problems with his temperament.
bropedo
Profile Joined April 2012
United States89 Posts
Last Edited: 2012-06-30 18:06:25
June 30 2012 18:03 GMT
#174
On July 01 2012 02:05 Waterflow wrote:
Show nested quote +
On June 30 2012 22:09 Leberwurstbrot wrote:
On June 30 2012 21:14 bLah. wrote:
On June 30 2012 19:59 Incognoto wrote:
You need to be careful, you seem really biased here. Idra is far from a complete moron and actually has an excellent understanding of the game. His last run at MLG wasn't as good as Orlando's or anything but he's far, very far, from incompetent. His results are comparable to many good foreigners so please don't call IdrA terrible just because he isn't dominating the scene in the one-sided manner he used to. He also isn't really bad mannered.. I'm pretty sure that he had a very civil discussion with Qxc. But I'm not here to talk about Idra.


idra never dominated the scene, and his "understanding of the game" is pretty different from what he shows everywhere, and that's whining. He didnt' have civil discussion with QXC. Idra had his "I'm completely right and telling you what to do" attitude in that conversation but QXC decided not to get pulled into that, while Avilo said what every terran meant and got "STFU".

it was stupid to get avilo into the show and then just diss him the whey they did. It was specifically stupid that it was guy who had show named "imbalanced" who dissed him.

but after all this incident I'm pretty sure avilo got more fans than others others on that show, so there's that


Yeah, maybe that what every Terran thinks is false..? IdrA tried to tell him but Avilo is just kinda stupid and can not understand what IdrA was saying. He said only the same shit, IdrA reacted completly right.


Acted completely right by saying "Shut the fuck up"?

He could of just said "Don't interrupt me" but chose the immature way of dealing with it instead. IdrA has problems with his temperament.

And Avilo could have not purposely interupted him and could have not sarcasticly agreed with Idra throughout half the conversation, forget the terrible arguements Avilo put up.
Just because you dont like Idra doesnt mean he is the only one who acted immature with a temper problem.
Gogo Terran: MKP ByuN || Toss: Parting Rain || Zerg: Life HyuN
Waterflow
Profile Joined May 2011
Sweden1550 Posts
Last Edited: 2012-06-30 18:25:46
June 30 2012 18:14 GMT
#175
On July 01 2012 03:03 bropedo wrote:
Show nested quote +
On July 01 2012 02:05 Waterflow wrote:
On June 30 2012 22:09 Leberwurstbrot wrote:
On June 30 2012 21:14 bLah. wrote:
On June 30 2012 19:59 Incognoto wrote:
You need to be careful, you seem really biased here. Idra is far from a complete moron and actually has an excellent understanding of the game. His last run at MLG wasn't as good as Orlando's or anything but he's far, very far, from incompetent. His results are comparable to many good foreigners so please don't call IdrA terrible just because he isn't dominating the scene in the one-sided manner he used to. He also isn't really bad mannered.. I'm pretty sure that he had a very civil discussion with Qxc. But I'm not here to talk about Idra.


idra never dominated the scene, and his "understanding of the game" is pretty different from what he shows everywhere, and that's whining. He didnt' have civil discussion with QXC. Idra had his "I'm completely right and telling you what to do" attitude in that conversation but QXC decided not to get pulled into that, while Avilo said what every terran meant and got "STFU".

it was stupid to get avilo into the show and then just diss him the whey they did. It was specifically stupid that it was guy who had show named "imbalanced" who dissed him.

but after all this incident I'm pretty sure avilo got more fans than others others on that show, so there's that


Yeah, maybe that what every Terran thinks is false..? IdrA tried to tell him but Avilo is just kinda stupid and can not understand what IdrA was saying. He said only the same shit, IdrA reacted completly right.


Acted completely right by saying "Shut the fuck up"?

He could of just said "Don't interrupt me" but chose the immature way of dealing with it instead. IdrA has problems with his temperament.

And Avilo could have not purposely interupted him and could have not sarcasticly agreed with Idra throughout half the conversation, forget the terrible arguements Avilo put up.
Just because you dont like Idra doesnt mean he is the only one who acted immature with a temper problem.


IdrA could chose to be the more mature one then. Isn't he older than Avilo?

Sure i don't like IdrA but i don't hate him eihter. Maybe he has a hard time controlling his temperament and in that case i can't fully blame him. But if that's the case then there's help out there. Im not even being disrespectful or trolling now. Im serious.

If he can control his anger though then i feel like he should choose to do that instead and be the bigger man.

But this discussion will lead nowhere so i wont continue to argue about this. Both were probably wrong in one way or another but afterall IdrA is the professional gamer out of the two and he represents a team aswell as sponsors.

If you can't agree that it sounded bad what IdrA said then there's no point in even discussing.
ShatterZer0
Profile Joined November 2010
United States1843 Posts
June 30 2012 18:55 GMT
#176
O.O This place exists. I wonder if the stream has changed at all in the past 8 months.
A time to live.
Alpino
Profile Joined June 2011
Brazil4390 Posts
June 30 2012 22:14 GMT
#177
On June 30 2012 23:26 gosublade wrote:
Show nested quote +
On June 30 2012 22:49 bLah. wrote:
On June 30 2012 22:09 Leberwurstbrot wrote:
Yeah, maybe that what every Terran thinks is false..? IdrA tried to tell him but Avilo is just kinda stupid and can not understand what IdrA was saying. He said only the same shit, IdrA reacted completly right.


It's probably true that every terran is false and that a guy who has saying "zerg isn't supposed to beat protoss" is completely right when he talks about balance and when he talks about how some race should just start playing better.

who knows


that quote is like a year old, your argument is invalid


he reiterated that quote in the beginning of the last GSL
20/11/2015 - never forget EE's Ember
Steelo_Rivers
Profile Blog Joined January 2011
United States1968 Posts
Last Edited: 2012-07-01 11:19:18
July 01 2012 08:40 GMT
#178
http://www.quickmeme.com/meme/3pxhw5/
ok
AluXez
Profile Joined January 2011
Norway51 Posts
July 01 2012 10:41 GMT
#179
I hardly ever post in TL.net, but there is one point avilo was making that i feel people didnt get, which is this:

The regular dynamic of ZvT is that terran is the aggressor and makes units to attack, while zerg tries to make as much defense as needed, while building drones. Its all about knowing how many, and which defensive units you need to survive. This generally works because terran makes units out of buildings, so terran makes units constantly, but at a slow rate. Because of that, zerg can play greedy. But the other way around, if terran plays greedy, that is far more dangerous. That is because if zerg sees for instance an early third from the terran, he can build 20 roaches more or less instantly and go for the win, while if terran sees and early third from zerg, he has to first build 6 raxes, then start training marines and 5 minutes later is ready for the attack. Thats why playing passively as zerg is easier and more effective than doing it with therran. It is way easier to predict how many troops terran will have in 5 minutes, than zerg.
I am the walrus
Vodh
Profile Joined May 2010
68 Posts
July 02 2012 01:45 GMT
#180
It's actually pretty sad to see how awful some people are with getting good and valid points across.

The one pretty important point in the Avilo and Idra discussion was that sure, if zerg decides to be greedy Terran can also be greedy, but it just works one way. Zerg can do whatever he wants, and if he decides to be greedy then except for some really extreme all-ins the worst that could happen to him is 'being forced' into a lategame, which is not bad at all. If Terran decides to be greedy, he's much more vulnerable. And with the way the Zerg economy develops it's easier for Zerg to reach the point where he can tech switch freely than for Terran to be able to do the same, which is also a relatively good point.

Avilo had a good shot at getting both of those across, but instead decided to focus on imputing a biased bs to Idra. There's a big difference between pointing out where TvZ is imbalanced, and calling the entire matchup an unwinable bs. It wasn't even a hard discussion to win, at the very least reach a draw. Sure, Idra was kinda bad mannered there, but how exactly is that news? JP and Idra were admittedly kind of biased towards Avilo, but he also got lost in his own argument towards the end, didn't really need much help to make himself sound stupid.
Are you ready, guys? Put ya gunz on!
Waterflow
Profile Joined May 2011
Sweden1550 Posts
Last Edited: 2012-07-02 14:30:21
July 02 2012 14:20 GMT
#181
On July 02 2012 10:45 Vodh wrote:
It's actually pretty sad to see how awful some people are with getting good and valid points across.

The one pretty important point in the Avilo and Idra discussion was that sure, if zerg decides to be greedy Terran can also be greedy, but it just works one way. Zerg can do whatever he wants, and if he decides to be greedy then except for some really extreme all-ins the worst that could happen to him is 'being forced' into a lategame, which is not bad at all. If Terran decides to be greedy, he's much more vulnerable. And with the way the Zerg economy develops it's easier for Zerg to reach the point where he can tech switch freely than for Terran to be able to do the same, which is also a relatively good point.

Avilo had a good shot at getting both of those across, but instead decided to focus on imputing a biased bs to Idra. There's a big difference between pointing out where TvZ is imbalanced, and calling the entire matchup an unwinable bs. It wasn't even a hard discussion to win, at the very least reach a draw. Sure, Idra was kinda bad mannered there, but how exactly is that news? JP and Idra were admittedly kind of biased towards Avilo, but he also got lost in his own argument towards the end, didn't really need much help to make himself sound stupid.


"Sure, Idra was kinda bad mannered there, but how exactly is that news?"

Just because he's known for being bad mannered and disrespectful doesn't make it more acceptable in any way. Stupid way of trying to sweep it under the rug.
TheLastTemplar
Profile Joined February 2012
Iceland593 Posts
Last Edited: 2012-07-03 15:41:18
July 03 2012 15:39 GMT
#182
Yo man I absolutely love state of the game and I dont think all the players on the shower were involved with what ahppened to you.. but I just want to say you conducted yourself well man and I was a little embarrased for sotg.. it was so obvious how flustered idra got because you wouldn't come down to his level.
I like greg a lot, but this was just lame. Why do people think they are so fucking important it makes me not even want to try to be apart of the community sometimes. Keep being you man take care
ladadidadi
RoieTRS
Profile Blog Joined July 2008
United States2569 Posts
July 07 2012 07:19 GMT
#183
Avilo u still play tennis?
konadora, in Racenilatr's blog: "you need to stop thinking about starcraft or anything computer-related for that matter. It's becoming a bad addiction imo"
Arkansassy
Profile Joined October 2010
358 Posts
July 07 2012 19:02 GMT
#184
He not only plays, he coaches and is good.

If anyone saw Incontrol ridicule avilo's lisp with his impression of Daffy Duck on SOTG prior to introducing avilo, please PM me. I searched the video three times and either I missed it, or it's been "conveniently deleted. Thanks.
StackerTwo
Profile Joined February 2012
United States41 Posts
July 19 2012 23:26 GMT
#185
so uh i randomly checked the grandmasters list today and LgNAvilo is #1 GM? but then there is another LgNAvilo #1 ranked masters?
oberhofer
Profile Blog Joined July 2011
Germany98 Posts
Last Edited: 2012-07-19 23:28:30
July 19 2012 23:27 GMT
#186
Someone knows who the LgNavilo is that is currently ranked #1 in American GM?

+ Show Spoiler +
[image loading]

http://us.battle.net/sc2/en/ladder/grandmaster
SC2 catchphrase.
Laneir
Profile Joined September 2010
United States1160 Posts
July 19 2012 23:38 GMT
#187
gotta be a fake avilo look at the guys last season never player so somebody trolling
Follow me on Instagram @Chef_Betto
Juggernaut477
Profile Joined May 2011
United States379 Posts
July 19 2012 23:39 GMT
#188
Its Major.Saw Idra talking to him on real ID
GreatFluke
Profile Blog Joined June 2011
Canada40 Posts
July 31 2012 22:06 GMT
#189
Sign me up!
Air Attack 2... Anyone?
Djagulingu
Profile Blog Joined December 2010
Germany3605 Posts
August 01 2012 01:50 GMT
#190
On July 02 2012 10:45 Vodh wrote:
It's actually pretty sad to see how awful some people are with getting good and valid points across.

The one pretty important point in the Avilo and Idra discussion was that sure, if zerg decides to be greedy Terran can also be greedy, but it just works one way. Zerg can do whatever he wants, and if he decides to be greedy then except for some really extreme all-ins the worst that could happen to him is 'being forced' into a lategame, which is not bad at all. If Terran decides to be greedy, he's much more vulnerable. And with the way the Zerg economy develops it's easier for Zerg to reach the point where he can tech switch freely than for Terran to be able to do the same, which is also a relatively good point.

Avilo had a good shot at getting both of those across, but instead decided to focus on imputing a biased bs to Idra. There's a big difference between pointing out where TvZ is imbalanced, and calling the entire matchup an unwinable bs. It wasn't even a hard discussion to win, at the very least reach a draw. Sure, Idra was kinda bad mannered there, but how exactly is that news? JP and Idra were admittedly kind of biased towards Avilo, but he also got lost in his own argument towards the end, didn't really need much help to make himself sound stupid.

Well, even during 2rax era, avilo claimed that TvZ is unplayable and shit so I can understand people who are negatively biased towards avilo's words on Terran non-mirror matchups.
"windows bash is a steaming heap of shit" tofucake
9-BiT
Profile Blog Joined January 2012
United States1089 Posts
August 01 2012 19:42 GMT
#191
On July 02 2012 23:20 Waterflow wrote:
Show nested quote +
On July 02 2012 10:45 Vodh wrote:
It's actually pretty sad to see how awful some people are with getting good and valid points across.

The one pretty important point in the Avilo and Idra discussion was that sure, if zerg decides to be greedy Terran can also be greedy, but it just works one way. Zerg can do whatever he wants, and if he decides to be greedy then except for some really extreme all-ins the worst that could happen to him is 'being forced' into a lategame, which is not bad at all. If Terran decides to be greedy, he's much more vulnerable. And with the way the Zerg economy develops it's easier for Zerg to reach the point where he can tech switch freely than for Terran to be able to do the same, which is also a relatively good point.

Avilo had a good shot at getting both of those across, but instead decided to focus on imputing a biased bs to Idra. There's a big difference between pointing out where TvZ is imbalanced, and calling the entire matchup an unwinable bs. It wasn't even a hard discussion to win, at the very least reach a draw. Sure, Idra was kinda bad mannered there, but how exactly is that news? JP and Idra were admittedly kind of biased towards Avilo, but he also got lost in his own argument towards the end, didn't really need much help to make himself sound stupid.


"Sure, Idra was kinda bad mannered there, but how exactly is that news?"

Just because he's known for being bad mannered and disrespectful doesn't make it more acceptable in any way. Stupid way of trying to sweep it under the rug.

I don't see how this is any better than what he was trying to 'sweep under the rug'. If you are going to respond to one sentence of a 2 paragraph post, you might as well not bother and accept that you lost the argument.

I do think that Avilo had a good point, but he went about it in the worst way possible.
kwark_uk: @father_sc learn to play maybe?
SMX995
Profile Joined October 2011
Venezuela3 Posts
Last Edited: 2012-08-09 03:45:53
August 09 2012 03:37 GMT
#192
yeah avilo! keep on it! owning protos and zergs like a boss!! and Sign me up! on that list of fans *-*

PD: i hope that there is not problem if i put a replay of me :o i am learning to play like avilo

http://drop.sc/235704
El que persevera alcanza
bigtabs
Profile Joined April 2012
Germany51 Posts
Last Edited: 2012-08-22 03:06:55
August 22 2012 03:06 GMT
#193
sign me up.. lots of fun in chat and a very entertaining streamer

all the best at MLG
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2012-08-22 17:01:48
August 22 2012 16:53 GMT
#194
Thanks for the support guys and a great big ty to Codon for working so hard to keep the fan club updated.

The link to the nuke replay pack is outta date. I told avilo about that months ago, but he hasn't updated the pack.

Also guess spoiler didn't work. LOL! Anyways, the captions on the pics are great!

I was just looking at the featured list and had to laugh. Avilo, who is non-featured (and should be) has been getting over 200 viewers regularly.

Some featured:

ROOTT1 - 53 viewers
Echo - 88 viewers
NASL (has to laugh) 113

Certainly, TL would not discriminate against avilo. Every time I've asked why he isn't featured yet, I've been told he doesn't have enough viewers and hasn't won any major tournaments. However, I've seen plenty of players on that list that have not won any "major" tournaments" and have hardly any viewers. Kinda makes me sad.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
August 30 2012 20:49 GMT
#195
On August 23 2012 01:53 Arkansassy wrote:
Thanks for the support guys and a great big ty to Codon for working so hard to keep the fan club updated.

The link to the nuke replay pack is outta date. I told avilo about that months ago, but he hasn't updated the pack.

Also guess spoiler didn't work. LOL! Anyways, the captions on the pics are great!

I was just looking at the featured list and had to laugh. Avilo, who is non-featured (and should be) has been getting over 200 viewers regularly.

Some featured:

ROOTT1 - 53 viewers
Echo - 88 viewers
NASL (has to laugh) 113

Certainly, TL would not discriminate against avilo. Every time I've asked why he isn't featured yet, I've been told he doesn't have enough viewers and hasn't won any major tournaments. However, I've seen plenty of players on that list that have not won any "major" tournaments" and have hardly any viewers. Kinda makes me sad.


lol, the other night there were a couple featured streamers with less than 10 (that's right, TEN!) viewers.
Procrastination is the enemy
Arkansassy
Profile Joined October 2010
358 Posts
September 05 2012 15:50 GMT
#196
Codon, thank you, again, for keeping avilo's fan club page lookin good.

Now that avilo is, once again, GM and on the top 50 streamer's list (although I feel there is a discrepancy in the actual numbers - 111?) I wonder if TL will consider featuring him. I won't hold my breath, but it seems a travesty that TL is holding him back.

I heard that EG runs TL, does anyone know if that's true? If so, then I know exactly why avilo has not been featured.
JacobShock
Profile Blog Joined April 2012
Denmark2485 Posts
September 05 2012 17:15 GMT
#197
On September 06 2012 00:50 Arkansassy wrote:
Codon, thank you, again, for keeping avilo's fan club page lookin good.

Now that avilo is, once again, GM and on the top 50 streamer's list (although I feel there is a discrepancy in the actual numbers - 111?) I wonder if TL will consider featuring him. I won't hold my breath, but it seems a travesty that TL is holding him back.

I heard that EG runs TL, does anyone know if that's true? If so, then I know exactly why avilo has not been featured.


TL's rival team runs their community website? Seems legit..
"Right on" - Morrow
Cokefreak
Profile Joined June 2011
Finland8095 Posts
September 05 2012 17:20 GMT
#198
On September 06 2012 00:50 Arkansassy wrote:
I heard that EG runs TL, does anyone know if that's true? If so, then I know exactly why avilo has not been featured.

wat
Arkansassy
Profile Joined October 2010
358 Posts
September 06 2012 14:44 GMT
#199
To both of the above...when I heard that, I was in disbelief, too. That's why I asked. Probably was someone just trolling me. I'm blonde, I'm gullible. hahaha
Jockmcplop
Profile Blog Joined February 2012
United Kingdom9834 Posts
September 17 2012 01:16 GMT
#200
Sign me up, Avilo's stream is great.
RIP Meatloaf <3
GreatFluke
Profile Blog Joined June 2011
Canada40 Posts
September 22 2012 23:08 GMT
#201
GoGo Lil'Johnny!!!
Air Attack 2... Anyone?
morrezor
Profile Joined July 2012
Sweden99 Posts
September 23 2012 10:31 GMT
#202
love your games man and you strreams nice too
89733
Profile Joined May 2011
Canada11 Posts
October 30 2012 18:21 GMT
#203
Please add me to fanclub
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2012-10-30 20:28:20
October 30 2012 20:27 GMT
#204
thz 89733, I'm sure as soon as Codon returns to his duties, he'll be happy to add you :D

Pretty sure he's in the storm area and is working now.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
November 12 2012 20:20 GMT
#205
Hello everyone!! Sorry about not updating the fan club. Sometimes I get distracted, and yeah, I actually have a job now! But anyway, everyone who requested to be added up to this point is now added, so welcome to the club!! :D
Procrastination is the enemy
bahunto28
Profile Joined October 2010
Canada262 Posts
December 11 2012 01:46 GMT
#206
when avilo stream next? haven't seen him on TL in ages.
meh
frantic.cactus
Profile Joined April 2010
New Zealand164 Posts
December 19 2012 00:07 GMT
#207
HAPPY BIRTHDAY AVILO! I've been a fan since you taught me to win TvP with mech guide out of 1/1/1 raven opening. So fun stomping noobs with the powerful tank, sad that those days are gone.

Anyhooo, just wanted to say that I hope you don't give up on Mech TvP as you've always been an outspoken advocate of my favorite style and hope you continue to produce epic games.

(Just as an aside, I always tune into your stream, but when I see Bio TvP I tune out as I find the least innovative and most predictably boring matchup. Even watching you loose sometimes with mech is more enjoyable for me as a fan and viewer)
Terran it up since 2007
avilo
Profile Blog Joined November 2007
United States4100 Posts
December 19 2012 18:32 GMT
#208
On December 19 2012 09:07 frantic.cactus wrote:
HAPPY BIRTHDAY AVILO! I've been a fan since you taught me to win TvP with mech guide out of 1/1/1 raven opening. So fun stomping noobs with the powerful tank, sad that those days are gone.

Anyhooo, just wanted to say that I hope you don't give up on Mech TvP as you've always been an outspoken advocate of my favorite style and hope you continue to produce epic games.

(Just as an aside, I always tune into your stream, but when I see Bio TvP I tune out as I find the least innovative and most predictably boring matchup. Even watching you loose sometimes with mech is more enjoyable for me as a fan and viewer)


Hey thanks. I am done with mech TvP until blizzard patches it or makes it better. I've done all the testing/feedback I can to blizzard directly, others have as well and nothing has changed nor is it more viable. I will be only playing bio TvP from this point forward unless something changes sorry about that !
Sup
Worldatwar
Profile Joined September 2012
12 Posts
December 19 2012 18:59 GMT
#209
Re-upload Avilo's epic nuclear replay pack, please.
Arkansassy
Profile Joined October 2010
358 Posts
December 20 2012 05:10 GMT
#210
We had fun on avilo's birthday and I was happy to have spent another birthday with him. :D Many, many more for you and each one better.
Doodsmack
Profile Blog Joined August 2010
United States7224 Posts
December 31 2012 05:42 GMT
#211
Have been watching his stream more and he did some hilarious commentating today. Sign me up.
avilo
Profile Blog Joined November 2007
United States4100 Posts
January 12 2013 00:12 GMT
#212
On December 31 2012 14:42 Doodsmack wrote:
Have been watching his stream more and he did some hilarious commentating today. Sign me up.


Thanks! More commentating tonight again, casting the pro-league matches.
Sup
Psychobabas
Profile Blog Joined March 2006
2531 Posts
March 16 2013 02:41 GMT
#213
Avilo fighting!
Goldfish
Profile Blog Joined August 2010
2230 Posts
March 18 2013 15:11 GMT
#214
Sign me up !
https://connect.microsoft.com/WindowsServerFeedback/feedback/details/741495/biggest-explorer-annoyance-automatic-sorting-windows-7-server-2008-r2-and-vista#details Allow Disable Auto Arrange in Windows 7+
Nekovivie
Profile Joined October 2011
United Kingdom2599 Posts
March 18 2013 15:16 GMT
#215
Watched a lot of your games back in CnC3 and RA3 days lol :p

Keep fighting bro
If you are not supporting K-Pop you are hurting E-Sports.
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2013-03-18 15:44:35
March 18 2013 15:41 GMT
#216
this man invented the double layered wall in RA3!
all that did was prevent fighting!

just kidding!
gl hf with HotS....
looking forward to more hair-brained, wild, and crazy army compositions that stretch the game to limits the game designers and tournament admins never envisioned!

when ae you and Idra going to settle your differences on the field of battle with a Bo7 or Bo9?

if i can get IMAX to put up some cash for a show match... r u game?
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
Kalfos
Profile Joined March 2013
Dominican Republic34 Posts
March 19 2013 20:37 GMT
#217
It's time to D-D-D-DDD-DUEL~! Add me Codon
Kalfos
Profile Joined March 2013
Dominican Republic34 Posts
March 24 2013 06:35 GMT
#218
Hey Guys I just felt I had to post this PoV from one of Avilos most recent games vs Zerg [TvZ](As Mech) Where Avilo makes the Zerg player use Blinding Cloud (Could of been from either reflex or (You're a Wizard Avilo~!) preemptively baited) on his Tank line while UN-sieged and just walking away from them. During this commotion in the front line of his army he is making Raven's and Thor's (With a sprinkle of Widow Mines) act as the "Main Target" to focus down the Hydras and Vipers away. This allowed him to not only keep his Tanks useful (But not at full efficiency) but also directly deny the Blinding Clouds effect on his army main source of DPS!

PoV: http://www.twitch.tv/avilo/b/381521736 (Around 4:40 is where the Battle begins)

Now I'm pretty sure I sound like a tape recorder at this point but we all know one thing: "Blinding Cloud turns Mech into a useless investment"

Widow Mines can overcome this maneuver since it's a spell. But counting on Widow Mines alone will pretty much lose you the game when Zerg players have a strong unit such as Ultralisk that can pretty much tank at least 2-3 Hits before being killed. Now of course this could be a "Situational" Scenario and won't be able to be applied to EVERY confrontation, But It does present at least a temporal opportunity towards Blinding Cloud when playing Mech.

If you find this not helpful then I'm sorry to have wasted your time.
jabberjaw
Profile Joined October 2010
225 Posts
March 24 2013 07:01 GMT
#219
add me. love the mech games!
Arkansassy
Profile Joined October 2010
358 Posts
March 30 2013 17:54 GMT
#220
I posted this in avilo's stream thread, but thought it should be brought to the fans who might have missed last night's game.

"If you missed the epic LOLs in a two-hr game v JazBas (zerg) last night, watch the replay. OMG too too funny.

http://www.twitch.tv/avilo/b/384093594

Game starts around the 2:31 point, but the epic craziness doesn't start until an hour into the game. So you have a whole hour of avilo funny. :D"
Wojciech Zywny
Profile Joined April 2013
Poland271 Posts
May 20 2013 03:13 GMT
#221
400+ viewers on his stream. He needs to be featured asap.

Also, huge fan. please add me to the fan club
Miecz przeznaczenia ma dwa ostrza. Jednym jesteś ty.
Emzeeshady
Profile Blog Joined January 2012
Canada4203 Posts
May 20 2013 03:18 GMT
#222
--- Nuked ---
avilo
Profile Blog Joined November 2007
United States4100 Posts
May 20 2013 05:53 GMT
#223
On May 20 2013 12:13 Wojciech Zywny wrote:
400+ viewers on his stream. He needs to be featured asap.

Also, huge fan. please add me to the fan club


I definitely agree! Let's get it up to 600 tomorrow !

On May 20 2013 12:18 Emzeeshady wrote:
Not a huge fan because he plays pretty boring but I do think he should be featured.


Haha, well, i guess if nukes in many places, ravens, and MECH are boring...but a lot of people don't think so! But thanks lol.
Sup
intense555
Profile Blog Joined February 2011
United States474 Posts
May 20 2013 05:59 GMT
#224
On May 20 2013 12:18 Emzeeshady wrote:
Not a huge fan because he plays pretty boring but I do think he should be featured.

A lot of people should be featured but TL has gotten pretty strict on who they feature. Avilo is really funny to watch.
Aspiring Starcraft 2 pro for @mYinsanityEU, follow me on twitter @mYintenseSC
FreSH_LiKe_Uhhh
Profile Joined April 2012
United States14 Posts
May 27 2013 20:06 GMT
#225
He plays boring? Oh, you mean Avilo doesn't do cheesy all-ins every game? yea.. he's a macro master, which is why i like watching him play. none of that one-base, two-base silliness.

Watching him Raven + Mech like a boss right now in TvT!! GOGOGOGo Avilo!!
Laneir
Profile Joined September 2010
United States1160 Posts
May 27 2013 20:21 GMT
#226
Avilo Fanclub sign me up lol
Follow me on Instagram @Chef_Betto
Emzeeshady
Profile Blog Joined January 2012
Canada4203 Posts
May 27 2013 20:34 GMT
#227
--- Nuked ---
Bloudemane
Profile Joined June 2013
France3 Posts
June 03 2013 06:39 GMT
#228
Hello Codon !

Please, add me to the fan club :D
sup sons ¯\_(ツ)_/¯
peidongyang
Profile Joined January 2009
Canada2084 Posts
June 03 2013 06:43 GMT
#229
the qq fanclub =D
the throws never bothered me anyway
dsousa
Profile Joined October 2011
United States1363 Posts
Last Edited: 2013-06-03 06:45:33
June 03 2013 06:45 GMT
#230
Avilo has been around long enough he deserves to be featured. Sticking it out in SC2 ain't easy. GL Avilo! TL help the guy out.
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2013-06-09 16:26:40
June 03 2013 19:45 GMT
#231
Codon is on vacation, but I will remind him to add those of you that have requested to become members.

IMO, avilo has a great fan base. You guys/girls are awesome. Thx for all your support through both good and bad times.
cpuser999
Profile Joined September 2012
United States8 Posts
June 08 2013 00:35 GMT
#232
Add me pls Thanks!!!
neoghaleon55
Profile Blog Joined August 2010
United States7435 Posts
June 08 2013 00:51 GMT
#233
I applaud this man's audacity to speak from his gut
<3
moo...for DRG
Mecto
Profile Joined June 2012
Canada41 Posts
June 08 2013 20:40 GMT
#234
Avilo aka our MoM aka our Master of Mech

avilo the roxxxor :D
Terran fighting
Wafflelisk
Profile Joined October 2011
Canada1061 Posts
June 11 2013 04:45 GMT
#235
Can I be part of your club or are waffles not cool enough of a breakfast food???
Waffles > Pancakes
The WingNut
Profile Joined February 2012
United States35 Posts
June 11 2013 14:52 GMT
#236
On May 28 2013 05:06 FreSH_LiKe_Uhhh wrote:
He plays boring? Oh, you mean Avilo doesn't do cheesy all-ins every game? yea.. he's a macro master, which is why i like watching him play. none of that one-base, two-base silliness.


He actually does have a few good cheesy builds. I wish he would do them more often...

And sometimes I wish he would play a few strong two base all-in timings, if just to help educate his stream viewers on what's out there

But yeah, macro-mech, super late-game, nuke harrass, I can dig that too.
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2013-06-11 16:14:19
June 11 2013 16:13 GMT
#237
On June 11 2013 13:45 Wafflelisk wrote:
Can I be part of your club or are waffles not cool enough of a breakfast food???


hahaha Waffles are good any time of day or night.

Codon is MIA atm and I'm not sure when he'll be back. Hopefully he checks in to add those new fans who wish to be added. Unfortunately, he did not appoint a back-up, but when I hear from him, I will direct him to the new names.

Thx Waffles

And thank you Wingnut for having been a loyal fan for a while now. :D
FreSH_LiKe_Uhhh
Profile Joined April 2012
United States14 Posts
June 13 2013 02:23 GMT
#238
And sometimes I wish he would play a few strong two base all-in timings, if just to help educate his stream viewers on what's out there


I actually agree, that would be pretty educational, and perhaps cool. I'm just glad he doesn't do that EVERY game like most punks on ladder.. -_-
codonbyte
Profile Blog Joined June 2011
United States840 Posts
June 14 2013 20:57 GMT
#239
My apologies to everyone who asked to be added and who didn't get added sooner.

I've had a lot on my plate lately. But I'm back for now! And everyone who asked to be added will be added in about 25 seconds after this message gets posted.

Thanks for all your support of Avilo!

Peace out everyone!
Procrastination is the enemy
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2013-06-15 17:30:35
June 15 2013 17:30 GMT
#240
Codon, you do an awesome job (when you're not MIA) maintaining the fan club page.

Thank you
codonbyte
Profile Blog Joined June 2011
United States840 Posts
June 15 2013 23:19 GMT
#241
No probs sazzypantz :D
Procrastination is the enemy
codonbyte
Profile Blog Joined June 2011
United States840 Posts
June 16 2013 16:29 GMT
#242
Updated the thread with a couple special events that are happening today. Check them out under News and Events. Also I mistakenly put June 7th for the date of Avilo's replay analysis on-stream. It's supposed to be today (june 16th, lol). Don't know how I managed to screw that up.

On another note, happy birthday Arkansassy!
Procrastination is the enemy
MajorTom89
Profile Joined March 2012
United States2 Posts
June 17 2013 02:59 GMT
#243
Nice fan club, Codon. Happy to be a part of it.
Afterstar
Profile Joined November 2010
67 Posts
Last Edited: 2013-06-17 14:23:49
June 17 2013 04:14 GMT
#244
Happy birthday Sassy, stay Classy.
The Avilo Win Anthem: + Show Spoiler +
Don't cry because it's over,smile because it happened.
HeathenHill
Profile Joined January 2012
Australia22 Posts
June 17 2013 04:32 GMT
#245
Yo avilo, loved the last replay analysis stream i caught when i was back in my hometown. I'll try and send in a decent loss or 2 where i can't see what i did wrong. Would also like some lessons, i have your skype and e-mail will try and organize it. Keep it up dude!
.Are we not the undisputed prodigy of warfare.
HeathenHill
Profile Joined January 2012
Australia22 Posts
June 17 2013 04:47 GMT
#246
And happy bday Sassy!
.Are we not the undisputed prodigy of warfare.
Arkansassy
Profile Joined October 2010
358 Posts
June 17 2013 19:23 GMT
#247
Thank you Afterstar and lol @ the avilo win anthem

Thank you, too HeathenHill and all those in chat who extended a birthday greeting. And ofc Codon, who sent a birthday greeting in PM. Y'all are awesome.

Avilo and I will be spending most of the day together...probably watching movies, cuz that's what we do. He never fails to make me feel special on my bday. But we'll probably be doing some GW too so he can piss me off. haha

Sorry he had to stay up so late, but it was a great way to start my day when I saw that he played until he made GM again. Think it took a whole one game. GJ, my avilo.
MATT TOAN
Profile Joined October 2012
Australia7 Posts
Last Edited: 2013-06-18 13:43:12
June 18 2013 13:34 GMT
#248
I have no doubt that Avilo created this fan club for himself, how could anybody enjoy watching the biggest whinger in this history of SC2?

User was warned for this post
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2013-06-18 22:34:03
June 18 2013 14:11 GMT
#249
On June 18 2013 22:34 MATT TOAN wrote:
I have no doubt that Avilo created this fan club for himself, how could anybody enjoy watching the biggest whinger in this history of SC2?

If you'd actually been watching his stream you'd see that he has greatly toned down the balance discussion. In particular, he always critiques his own errors BEFORE he talks about the balance of the game, which isn't something he used to do. . Also, no, I created the fan club, not Avilo. If you need me to prove that I am not Avilo, I can do that.

Also, what's a whinger?
Procrastination is the enemy
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2013-06-18 17:37:57
June 18 2013 17:34 GMT
#250
Okay, ffs...I don't know where people get all this "avilo whines" but I've watched his stream and read his posts probably longer than any of y'all and frankly I'm tired of haters perpetuating this crap!

Has he gotten frustrated when he loses to maphackers and cheaters and allins game after frickin game? Hell ya...who the heck doesn't? Has he been BM and raged because of it? Another big yes, but he's not the only one who's ever done that either! Is he one of the first to recognize imbalance. NO! But he is the first to voice his opinion and for that he's ostracized, which to me seems pretty unfair. He doesn't just say Terran is Underpowered, he tells Blizzard the aspects of Terran that are OP, as well.

Codon says he's "toned down the whining." Well I disagree with Codon, because I don't think it was whining. What avilo HAS done is adopted a better attitude and has become more objective with his own game play.

So, please, haters, once and for all STOP!

And a P.S. to Matt - Codon is not avilo, but one of avilo's many fans who recognize avilo's awesome talent and enjoy his entertaining and informative stream.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
June 18 2013 19:12 GMT
#251
On June 19 2013 02:34 Arkansassy wrote:
Okay, ffs...I don't know where people get all this "avilo whines" but I've watched his stream and read his posts probably longer than any of y'all and frankly I'm tired of haters perpetuating this crap!

Has he gotten frustrated when he loses to maphackers and cheaters and allins game after frickin game? Hell ya...who the heck doesn't? Has he been BM and raged because of it? Another big yes, but he's not the only one who's ever done that either! Is he one of the first to recognize imbalance. NO! But he is the first to voice his opinion and for that he's ostracized, which to me seems pretty unfair. He doesn't just say Terran is Underpowered, he tells Blizzard the aspects of Terran that are OP, as well.

Codon says he's "toned down the whining." Well I disagree with Codon, because I don't think it was whining. What avilo HAS done is adopted a better attitude and has become more objective with his own game play.

So, please, haters, once and for all STOP!

And a P.S. to Matt - Codon is not avilo, but one of avilo's many fans who recognize avilo's awesome talent and enjoy his entertaining and informative stream.

The team liquid community uses the term "balance whining" to refer to any discussion of game balance whatsoever. When I said he's toned down the whining, I wasn't implying that he was actually whining, I was just using Liquidspeak.

The important thing, though, is that Avilo now critiques his OWN play after a loss before commenting on balance, which has resulted in him moving from around rank 100 GM all the way up to rank 17 GM.
Procrastination is the enemy
HeathenHill
Profile Joined January 2012
Australia22 Posts
June 20 2013 23:16 GMT
#252
Avilo shouldn't change to suit these people. I enjoy his stream because he has the balls to speak his mind and have a laugh in the process.. He cops all the garbage people throw at him on the chin and keeps on doing his thing. The haters aren't going to stop unless he stops all together or panders to their expectations of what and how a Sc2 player should be/act. Let them post their nonsense. Most of these people ragging on Avilo are timid souls in the real world but so very strong behind their keyboard.

*Whinger is an Australian term for someone who complains about something alot. I will say as one of Avilo's loyal fans over the past 2 years that he does "whinge". Do i care..no, sometimes its amusing and if you don't like it DON'T WATCH THE STREAM BRO!

One of my favorite memories of watching Avilo is him complaining about something....i forget what...but he was on the verge of exploding. He started a new game and was talking about how bad is luck is (which sometimes it really is), he went to swap Factory -> reactor from rax and just as he was half way through about 10-15 lings ran through the gap, denying the factory from dropping and taking out his Scv's. He looked down, shook his head, threw the headphones off his head and just walked away without saying a word. He didn't come back for like 4-5 minutes. I was in hysterics, dude is a legend.
.Are we not the undisputed prodigy of warfare.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
June 20 2013 23:48 GMT
#253
On June 21 2013 08:16 HeathenHill wrote:
Avilo shouldn't change to suit these people. I enjoy his stream because he has the balls to speak his mind and have a laugh in the process.. He cops all the garbage people throw at him on the chin and keeps on doing his thing. The haters aren't going to stop unless he stops all together or panders to their expectations of what and how a Sc2 player should be/act. Let them post their nonsense. Most of these people ragging on Avilo are timid souls in the real world but so very strong behind their keyboard.

*Whinger is an Australian term for someone who complains about something alot. I will say as one of Avilo's loyal fans over the past 2 years that he does "whinge". Do i care..no, sometimes its amusing and if you don't like it DON'T WATCH THE STREAM BRO!

One of my favorite memories of watching Avilo is him complaining about something....i forget what...but he was on the verge of exploding. He started a new game and was talking about how bad is luck is (which sometimes it really is), he went to swap Factory -> reactor from rax and just as he was half way through about 10-15 lings ran through the gap, denying the factory from dropping and taking out his Scv's. He looked down, shook his head, threw the headphones off his head and just walked away without saying a word. He didn't come back for like 4-5 minutes. I was in hysterics, dude is a legend.

lol I remember that incident. It was pretty funny

Don't worry man, Avilo's never going to try and please haters. He has been working on improving his attitude lately, but that's more for his own benefit. And benefit him it has. Not only has he been visibly happier on-stream, but his ranking has improved phenominally. He used to be around rank 120, but now he's at about rank 50, and was even at rank 17 a couple days ago. He's also vastly improved his ability to hold off all-ins, which were the main way he was losing.

But yeah, don't worry, he'll always be strong and outspoken, which is a good thing. We need more people like that in the world
Procrastination is the enemy
Kalfos
Profile Joined March 2013
Dominican Republic34 Posts
Last Edited: 2013-06-21 01:25:41
June 21 2013 01:24 GMT
#254
On June 18 2013 22:34 MATT TOAN wrote:
I have no doubt that Avilo created this fan club for himself, how could anybody enjoy watching the biggest whinger in this history of SC2?


It's only Avilo, Why you heef to be mad?
starslayer
Profile Joined August 2011
United States696 Posts
June 21 2013 05:04 GMT
#255
fuck it this guy has such sick games sign me up.
i came here to kickass and chew bubblegum and i'm all out of bubble gum
LuckyFool
Profile Blog Joined June 2007
United States9015 Posts
June 21 2013 05:25 GMT
#256
great stream numbers over the past couple weeks avilo keep it up.
Arkansassy
Profile Joined October 2010
358 Posts
June 21 2013 05:36 GMT
#257
Yeah, Codon is right...the attitude adjustment really was for avilo's benefit and now that's he's been more positive he's winning games that you wouldn't think possible to win.

If you've been watching him for a couple years Heathenhill you know he's not gonna change. He calls it like he sees it and isn't afraid to speak his mind no matter what. To hell with the haters.

Tonight's last game was epic. Just made me smile from ear to ear. Gotta love them nukes.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
June 21 2013 05:42 GMT
#258
On June 21 2013 14:36 Arkansassy wrote:
Yeah, Codon is right...the attitude adjustment really was for avilo's benefit and now that's he's been more positive he's winning games that you wouldn't think possible to win.

If you've been watching him for a couple years Heathenhill you know he's not gonna change. He calls it like he sees it and isn't afraid to speak his mind no matter what. To hell with the haters.

Tonight's last game was epic. Just made me smile from ear to ear. Gotta love them nukes.

He was amazingly patient against the blink-stalker obnoxiousness. I thought he was going to be picked apart by the constant hit-and-run blink stalker attacks, but nope! He stayed calm and cool and managed to break through eventually.
Procrastination is the enemy
codonbyte
Profile Blog Joined June 2011
United States840 Posts
June 24 2013 19:04 GMT
#259
I just updated the fanclub with some screenshots of Avilo stomping RatZDeezer. I felt that a loathsome stream-cheater getting spanked deserves to be at the top of the fanclub
Procrastination is the enemy
FpSsSlayeR
Profile Joined April 2011
Germany22 Posts
June 24 2013 19:12 GMT
#260
On June 25 2013 04:04 codonbyte wrote:
I just updated the fanclub with some screenshots of Avilo stomping RatZDeezer. I felt that a loathsome stream-cheater getting spanked deserves to be at the top of the fanclub

I'm pretty sure that this RatzDeezer was probably just a Deezer wannabe troll, since Deezer doesn't play SCII anymore.
( Apparently he's now a "semi pro" LoL player.)
On June 19 2012 02:35 Liquid`NonY wrote: Are you seriously upset about people on TL.net knowing a god damn TSL champion? Get a grip son.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
June 24 2013 19:17 GMT
#261
On June 25 2013 04:12 FpSsSlayeR wrote:
Show nested quote +
On June 25 2013 04:04 codonbyte wrote:
I just updated the fanclub with some screenshots of Avilo stomping RatZDeezer. I felt that a loathsome stream-cheater getting spanked deserves to be at the top of the fanclub

I'm pretty sure that this RatzDeezer was probably just a Deezer wannabe troll, since Deezer doesn't play SCII anymore.
( Apparently he's now a "semi pro" LoL player.)

Hmm... well he sure did a pretty good impression of Deezer. In my book, if you act like Deezer then you may as well be Deezer.
Procrastination is the enemy
JDfz
Profile Joined December 2012
United Kingdom50 Posts
June 24 2013 21:06 GMT
#262
Sign me up! Very entertaining stream, in terms of the way he plays, the commentary he provides, and his personality. I hope he gets featured soon, its deserved for sure. Definitely need to turn your earphones down though, those kung fu moves can hit hard.
CJGumiho <3
Slabocans
Profile Joined June 2013
Australia4 Posts
July 02 2013 04:32 GMT
#263
GG Avilo, thanks for the tips, Keep streaming
Drinking beer
etsharry
Profile Joined February 2013
20 Posts
July 12 2013 21:50 GMT
#264
GGs!
Thank u very much again for ur free replayanalysis, avilo, i will never forget it! I'm the green Reaper. Best and most entertaining commented Terran stream right now in my opinion. Some ppl hate u for having a strong character and then complaining about to few characters in the scene (and eventually watching IdrA -.-). I love u for that. Big fan. <3
lamprey1
Profile Joined June 2012
Canada919 Posts
July 13 2013 18:14 GMT
#265
i'm looking forward to Avilo getting into the new C&C beta test and stretching the limits of the game.
avilo
Profile Blog Joined November 2007
United States4100 Posts
Last Edited: 2013-07-13 19:18:59
July 13 2013 19:18 GMT
#266
On June 25 2013 06:06 JDfz wrote:
Sign me up! Very entertaining stream, in terms of the way he plays, the commentary he provides, and his personality. I hope he gets featured soon, its deserved for sure. Definitely need to turn your earphones down though, those kung fu moves can hit hard.


Yes, yes they can. Cover your ears :D lol

On July 02 2013 13:32 Slabocans wrote:
GG Avilo, thanks for the tips, Keep streaming


np, more to come

On July 13 2013 06:50 etsharry wrote:
GGs!
Thank u very much again for ur free replayanalysis, avilo, i will never forget it! I'm the green Reaper. Best and most entertaining commented Terran stream right now in my opinion. Some ppl hate u for having a strong character and then complaining about to few characters in the scene (and eventually watching IdrA -.-). I love u for that. Big fan. <3


Honored your first post was in this thread :D any time a reaper is afk or chillin in a bunker it will be forever immortalized on my stream as the ETSHarry reaper lol.



On July 14 2013 03:14 lamprey1 wrote:
i'm looking forward to Avilo getting into the new C&C beta test and stretching the limits of the game.


Hell yes. SC2 is my priority obviously when it comes to gaming/e-sports but when generals 2 comes out i'll surely play and stream a lot of it as well and play in some tourneys if there are any. Oh and break the metagame

And thanks codon for making this thread btw and updating it so often, hope you know that i do appreciate it even if i haven't posted in here much or said much about it. The first post is updated with some epic stuff that even i didn't remember i did or said before lmao
Sup
lamprey1
Profile Joined June 2012
Canada919 Posts
July 15 2013 13:48 GMT
#267
the "complaint" i've read about you is that you complain about SC2 a lot.

but, when i watch you play on your stream it looks to me like you are having a great time.
intense555
Profile Blog Joined February 2011
United States474 Posts
July 18 2013 00:57 GMT
#268
On June 25 2013 04:17 codonbyte wrote:
Show nested quote +
On June 25 2013 04:12 FpSsSlayeR wrote:
On June 25 2013 04:04 codonbyte wrote:
I just updated the fanclub with some screenshots of Avilo stomping RatZDeezer. I felt that a loathsome stream-cheater getting spanked deserves to be at the top of the fanclub

I'm pretty sure that this RatzDeezer was probably just a Deezer wannabe troll, since Deezer doesn't play SCII anymore.
( Apparently he's now a "semi pro" LoL player.)

Hmm... well he sure did a pretty good impression of Deezer. In my book, if you act like Deezer then you may as well be Deezer.

NMx swoozy pretends to be deezer
Aspiring Starcraft 2 pro for @mYinsanityEU, follow me on twitter @mYintenseSC
Weavel
Profile Joined January 2010
Finland9223 Posts
August 04 2013 18:00 GMT
#269
Sign me up! I've been having a blast watching his stream lately.
Life/Seed//Mvp/NaNiwa fighting! ZeNEX forever!
F.O.A.D.
Profile Joined July 2013
Canada100 Posts
August 04 2013 19:09 GMT
#270
grumpy terran has fan club? lul
Reenock | Gumibro | Soulkey | sC | jjakji | Mvp | Innovation | Seed | Hurricane | Sniper | Dream | Maru
Arkansassy
Profile Joined October 2010
358 Posts
August 06 2013 15:31 GMT
#271
"Grumpy terran?"

Avilo is one of the most fun and funny streamers around so, I'm guessing you were just joking or you never watch the stream.
HeathenHill
Profile Joined January 2012
Australia22 Posts
August 10 2013 00:16 GMT
#272
I've noticed a change in your attitude while streaming over the past few weeks, i was hoping you wouldn't change your ways but i will say that i'm enjoying it. You seem more positive in your plays and even your mistakes. Been watching your stream for over a year now and it's still pretty much the only one i watch due to most other streamers being really boring individuals.. I normally have to watch your past broadcasts though as the times dont always link up due to my work but regardless....

Good F*****g work dude.

MECH IT HAPPEN
.Are we not the undisputed prodigy of warfare.
avilo
Profile Blog Joined November 2007
United States4100 Posts
August 10 2013 21:11 GMT
#273
On August 10 2013 09:16 HeathenHill wrote:
I've noticed a change in your attitude while streaming over the past few weeks, i was hoping you wouldn't change your ways but i will say that i'm enjoying it. You seem more positive in your plays and even your mistakes. Been watching your stream for over a year now and it's still pretty much the only one i watch due to most other streamers being really boring individuals.. I normally have to watch your past broadcasts though as the times dont always link up due to my work but regardless....

Good F*****g work dude.

MECH IT HAPPEN


Thanks i appreciate that. I usually try and take out frustration of my own mistakes at myself now and berate myself instead of opponent's so much :D that is of course when they do happen...i'm making a lot less mistakes now too :D
Sup
Kevm3O
Profile Joined August 2013
3 Posts
August 27 2013 01:39 GMT
#274
Sign me up and please feature Avilo Team Liquid, he has an amazing stream and a good amount of viewers!
rel
Profile Blog Joined January 2005
Guam3521 Posts
August 27 2013 02:10 GMT
#275
SIGN ME UP, Avilo is best streamer on tl.
I'll tank push my way into her heart. ☮♥&$!
SwitchAUS
Profile Joined June 2011
Australia106 Posts
August 27 2013 02:18 GMT
#276
On August 11 2013 06:11 avilo wrote:
Thanks i appreciate that. I usually try and take out frustration of my own mistakes at myself now and berate myself instead of opponent's so much :D that is of course when they do happen...i'm making a lot less mistakes now too :D


if you've changed your mindset maybe people will dislike you a little less. Will tune in to hopefully see less whine and more meching it happen.
I'm awesome, and I f--k dolphins.
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2013-08-27 17:29:23
August 27 2013 17:02 GMT
#277
On August 27 2013 11:18 SwitchAUS wrote:
Show nested quote +
On August 11 2013 06:11 avilo wrote:
Thanks i appreciate that. I usually try and take out frustration of my own mistakes at myself now and berate myself instead of opponent's so much :D that is of course when they do happen...i'm making a lot less mistakes now too :D


if you've changed your mindset maybe people will dislike you a little less. Will tune in to hopefully see less whine and more meching it happen.


What a nice sentiment, "people will dislike you a 'little' less." lol As we both know haters gonna hate no matter what.

Avilo's fans are some of the most devoted and supportive fans I've ever come across. He strives to be the best player he can be and whilst his new outlook was, in part, to help him improve his game, it was also intended to make his fans proud of him, but the only thing that really matters is that at the end of the day avilo can look in the mirror and be proud of himself.

gOgO avilO


mafaba
Profile Joined April 2013
Germany73 Posts
August 27 2013 17:28 GMT
#278
Does he always wear this hat? if yes sign me up.
SYG
Profile Joined June 2013
United States3 Posts
August 30 2013 01:54 GMT
#279
Make me a fan now!
Stand Your Ground!
Arkansassy
Profile Joined October 2010
358 Posts
August 30 2013 16:17 GMT
#280
To all those requesting a membership into the Avilo Fan Club:

Codonbyte, the originator and president of the fan club has been slacking a bit for very good reasons. He's now working 40 hrs a week and has been making minecraft videos. He has yet to find a way to organize his time in order to maintain the fan club. I'm sure when he does, y'all will be added. Don't give up hope.

He has done a great job putting this fan club together. As we all know, it takes hard work and dedication to maintain a fan club and keep it up to date.

If there is any interest in assisting Codon, please PM me.

In the mean time, thanks for your patience. :D
Painiyff
Profile Joined May 2013
Canada26 Posts
August 31 2013 03:49 GMT
#281
sign me up too
avilo pretty good.. except tvp
Mansef
Profile Joined May 2012
59 Posts
August 31 2013 04:24 GMT
#282
This guy is probably the biggest piece of shit I've ever seen. An autistic, whiny, spastic little fuck who actually has the audacity to balance whine and blame all his losses on stream cheaters or balance. What a dumb little fucking waste of life.

User was temp banned for this post.
Arkansassy
Profile Joined October 2010
358 Posts
August 31 2013 18:22 GMT
#283
Shame on you, Mansef.

You speak of audacity? It takes quite a bit more audacity to come into someone's Fan Club and display such bad manners. Why would you embarrass yourself like that? If you actually watched more than one game, you'd realize how wrong you are.

Thank you to the mod who recognized Mansef's statement as being totally inappropriate.
rel
Profile Blog Joined January 2005
Guam3521 Posts
September 01 2013 00:47 GMT
#284
Someone jelly of avilo....
I'll tank push my way into her heart. ☮♥&$!
codonbyte
Profile Blog Joined June 2011
United States840 Posts
September 09 2013 01:00 GMT
#285
On September 01 2013 09:47 rel wrote:
Someone jelly of avilo....

Jelly and sour about that temp ban XD
Procrastination is the enemy
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2013-09-09 01:04:59
September 09 2013 01:01 GMT
#286
Whew, sorry bout that long-ass absence on my part. Damn, I hate working 40 hours per week. It sucks

That and I got hooked on re-reading the Harry Potter books over and over again. Dat shit's addictive. Anyway, I'm BACK!!! And all new members who were requesting to be added have now been added. WElcome to Avilo's fanclub!! :D

Edit: oh and did I mention that I had car trouble? It sucks when you get up in the morning to go to work and there's a huge grinding sound and the car barely moves and it's on a holiday weekend so I have to wait three days to get it back from the shop -.-
Procrastination is the enemy
intense555
Profile Blog Joined February 2011
United States474 Posts
September 09 2013 04:14 GMT
#287
On August 31 2013 13:24 Mansef wrote:
This guy is probably the biggest piece of shit I've ever seen. An autistic, whiny, spastic little fuck who actually has the audacity to balance whine and blame all his losses on stream cheaters or balance. What a dumb little fucking waste of life.

User was temp banned for this post.

Pretty much everyone who has played avilo that Ive talked to has said this, avilo really does blame all of his losses on cheaters or balance, it does get frustrating.
Aspiring Starcraft 2 pro for @mYinsanityEU, follow me on twitter @mYintenseSC
prOkilleR
Profile Joined April 2013
United States58 Posts
September 09 2013 04:14 GMT
#288
y no GM?
avilo
Profile Blog Joined November 2007
United States4100 Posts
September 09 2013 05:17 GMT
#289
On September 09 2013 13:14 intense555 wrote:
Show nested quote +
On August 31 2013 13:24 Mansef wrote:
This guy is probably the biggest piece of shit I've ever seen. An autistic, whiny, spastic little fuck who actually has the audacity to balance whine and blame all his losses on stream cheaters or balance. What a dumb little fucking waste of life.

User was temp banned for this post.

Pretty much everyone who has played avilo that Ive talked to has said this, avilo really does blame all of his losses on cheaters or balance, it does get frustrating.


You obviously have never seen my stream, or are here to troll. I usually give a short analysis of the mistakes i made after i lose a game where i make them.

Anything else is just me being humorous 90% of the time, making jokes about anything SC related, whether it's strategies, players, or perceived balance by the community or myself.

As for cheaters, there was a week or two stint where i regularly had people sniping my stream and watching while playing me or verified map hackers that were stream sniping to troll. Otherwise, i rarely will call someone a cheater.

Sup
Caliber
Profile Joined August 2010
United States598 Posts
September 15 2013 00:17 GMT
#290
sign me up plz
codonbyte
Profile Blog Joined June 2011
United States840 Posts
September 17 2013 16:06 GMT
#291
On September 15 2013 09:17 ROOTCaliber wrote:
sign me up plz

Done! Welcome to the club :D
Procrastination is the enemy
codonbyte
Profile Blog Joined June 2011
United States840 Posts
September 17 2013 16:14 GMT
#292
On September 09 2013 13:14 intense555 wrote:
Show nested quote +
On August 31 2013 13:24 Mansef wrote:
This guy is probably the biggest piece of shit I've ever seen. An autistic, whiny, spastic little fuck who actually has the audacity to balance whine and blame all his losses on stream cheaters or balance. What a dumb little fucking waste of life.

User was temp banned for this post.

Pretty much everyone who has played avilo that Ive talked to has said this, avilo really does blame all of his losses on cheaters or balance, it does get frustrating.

Like many streamers, Avilo has had the frustrating experience of being stream-sniped/cheated. He has, on occasion, had an entire night of streaming ruined by being repeatedly matched up against a stream-cheater. Such experiences have made him rather paranoid about it. Many streamers are in a similar boat.

That being said, he doesn't blame all his losses on stream-cheating. He only does it when his opponent gets unusually "lucky" with blind decisions.
Procrastination is the enemy
ROOTFayth
Profile Joined January 2004
Canada3351 Posts
September 18 2013 17:36 GMT
#293
Big fan
TT1
Profile Blog Joined December 2008
Canada10035 Posts
September 18 2013 17:38 GMT
#294
the one and only true na god, sign me up
ab = tl(i) + tl(pc), the grand answer to every tl.net debate
Gophar
Profile Joined July 2010
France49 Posts
September 18 2013 17:38 GMT
#295
Sign me up !

Team Brovilo !
KiWiKaKi
Profile Joined February 2010
Canada691 Posts
September 18 2013 17:39 GMT
#296
sign me up
ur pro or ur noob , thats life
Liquid`Sheth
Profile Blog Joined March 2010
United States2095 Posts
September 18 2013 17:40 GMT
#297
Anyone Kiwi is a fan of, I'm a fan of. Avilo Fighting!
Team LiquidUnderneath it all they were really quite nice. They just got screwed up. Mostly by stuff that wasn't entirely their fault.
ToD
Profile Joined December 2008
France222 Posts
September 18 2013 18:25 GMT
#298
sign me up
Commentator
DinosaurJones
Profile Joined February 2012
United States1000 Posts
September 18 2013 18:30 GMT
#299
All dem Pros O_o
Drunkenboi
Profile Joined September 2010
Canada15 Posts
September 18 2013 18:53 GMT
#300
huge fan sign me up
Kokokoz
Profile Joined April 2013
France147 Posts
September 18 2013 19:01 GMT
#301
On September 19 2013 03:25 ToD wrote:
sign me up


ahahha
LuckyFool
Profile Blog Joined June 2007
United States9015 Posts
September 18 2013 19:24 GMT
#302
I've been a fan since day 1 ez.

I even PM'd avilo before MLG Raleigh 2010 wishing him good luck, that is true fandom support from the very beginning right there. After the 4 hour bo3 vs painuser I was hooked.
TT1
Profile Blog Joined December 2008
Canada10035 Posts
September 18 2013 19:40 GMT
#303
stfu ive been an avilo fan since bw
ab = tl(i) + tl(pc), the grand answer to every tl.net debate
LuckyFool
Profile Blog Joined June 2007
United States9015 Posts
September 20 2013 21:13 GMT
#304
avilo didn't even really play bw competitively, he played command and conquer, if ur gonna be a true diehard fan you need to know ur facts son!
bahunto28
Profile Joined October 2010
Canada262 Posts
September 21 2013 00:59 GMT
#305
sign me up plz :D
meh
Joedaddy
Profile Blog Joined July 2010
United States1948 Posts
September 22 2013 10:32 GMT
#306
On September 19 2013 03:25 ToD wrote:
sign me up


On September 19 2013 02:39 KiWiKaKi wrote:
sign me up


On September 19 2013 02:38 TT1 wrote:
the one and only true na god, sign me up


On September 19 2013 02:36 ROOTFayth wrote:
Big fan


On September 15 2013 09:17 ROOTCaliber wrote:
sign me up plz


I think ROOT is trolling lol~ did Avilo have a run in with someone from ROOT recently?
I might be the minority on TL, but TL is the minority everywhere else.
Kalfos
Profile Joined March 2013
Dominican Republic34 Posts
September 22 2013 17:01 GMT
#307
What do you mean? I know he played (Z)Najzmajs this past week where avilo showed him some of Protoss strong builds vs Terran and a TvZ &TvT vs him on the ladder. There was also the Catz vs Him these past week and Puck was also there. And Kiwi and Nathan are cool guys.
Mansef
Profile Joined May 2012
59 Posts
September 27 2013 19:05 GMT
#308
A literal piece of shit.

User was banned for this post.

User was warned for this post
lamprey1
Profile Joined June 2012
Canada919 Posts
Last Edited: 2013-09-27 20:04:48
September 27 2013 20:01 GMT
#309
Avilo,
have you been invited to the C&C Alpha Test yet?

I have, and i'm a "nobody".

Hopefully, you get invited soon.

I'm sure GR.Org would give you an Alpha key.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
September 30 2013 01:05 GMT
#310
On September 28 2013 04:05 Mansef wrote:
A literal piece of shit.

User was banned for this post.

User was warned for this post

Thank you, TL mods.
Procrastination is the enemy
dvorakftw
Profile Blog Joined November 2011
681 Posts
October 01 2013 20:04 GMT
#311
On September 22 2013 19:32 Joedaddy wrote:
Show nested quote +
On September 19 2013 03:25 ToD wrote:
sign me up


Show nested quote +
On September 19 2013 02:39 KiWiKaKi wrote:
sign me up


Show nested quote +
On September 19 2013 02:38 TT1 wrote:
the one and only true na god, sign me up


Show nested quote +
On September 19 2013 02:36 ROOTFayth wrote:
Big fan


Show nested quote +
On September 15 2013 09:17 ROOTCaliber wrote:
sign me up plz


I think ROOT is trolling lol~ did Avilo have a run in with someone from ROOT recently?

I think it must have been avilo taking out CatZ in the IEM American Cup tourney in front of so many people watching on MLG.



The shame of it is I'd think avilo would be an AMAZING practice partner and teammate.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
October 02 2013 02:45 GMT
#312
On October 02 2013 05:04 dvorakftw wrote:
Show nested quote +
On September 22 2013 19:32 Joedaddy wrote:
On September 19 2013 03:25 ToD wrote:
sign me up


On September 19 2013 02:39 KiWiKaKi wrote:
sign me up


On September 19 2013 02:38 TT1 wrote:
the one and only true na god, sign me up


On September 19 2013 02:36 ROOTFayth wrote:
Big fan


On September 15 2013 09:17 ROOTCaliber wrote:
sign me up plz


I think ROOT is trolling lol~ did Avilo have a run in with someone from ROOT recently?

I think it must have been avilo taking out CatZ in the IEM American Cup tourney in front of so many people watching on MLG.

http://www.youtube.com/watch?v=s-oHkEDzELw

The shame of it is I'd think avilo would be an AMAZING practice partner and teammate.

Thank you for posting this, Dvorak. I'll add it to the top of the fanclub, where I SHOULD have added it ages ago (sorry bout my slaking, 'vilo fans, my Truant ability makes it hard for me to keep up with things).
Procrastination is the enemy
Arkansassy
Profile Joined October 2010
358 Posts
October 02 2013 04:36 GMT
#313
Sazzypantz doubts I'll do a better job at keeping up with this game, and I prove her wrong by adding the exchange to "Avilo's Chat EPICNESS!". Take THAT sazzypantz!

I only speak the truth :D

*Godfrog is the biggest, baddest, cutest, sweetest, creepiest, most annoying troll to ever grace Avilo's stream chat. Click here to check out this post that he made, which should give you an idea of what he was like in-chat.

You forgot to mention stalker and someone who makes threats against women.

Anyways, GJ with the new addition, Codon.

codonbyte
Profile Blog Joined June 2011
United States840 Posts
October 02 2013 04:48 GMT
#314
On October 02 2013 13:36 Arkansassy wrote:
Sazzypantz doubts I'll do a better job at keeping up with this game, and I prove her wrong by adding the exchange to "Avilo's Chat EPICNESS!". Take THAT sazzypantz!

I only speak the truth :D

*Godfrog is the biggest, baddest, cutest, sweetest, creepiest, most annoying troll to ever grace Avilo's stream chat. Click here to check out this post that he made, which should give you an idea of what he was like in-chat.

You forgot to mention stalker and someone who makes threats against women.

Anyways, GJ with the new addition, Codon.


lol don't worry, I didn't forget. I added it just now. And I sent you a PM on twitch. Anywho, Peace out sazzypantz! :D
Procrastination is the enemy
dvorakftw
Profile Blog Joined November 2011
681 Posts
October 02 2013 13:30 GMT
#315
On October 02 2013 13:36 Arkansassy wrote:
*Godfrog is the biggest, baddest, cutest, sweetest, creepiest, most annoying troll to ever grace Avilo's stream chat. Click here to check out this post that he made, which should give you an idea of what he was like in-chat.

You forgot to mention stalker and someone who makes threats against women.


I don't see any mention that she's a frog
ZaMa
Profile Joined August 2013
United States38 Posts
October 04 2013 00:35 GMT
#316
photon discs stuff soon right? xD avilo's loving that arcade game now
hangene92
Profile Blog Joined October 2011
Canada258 Posts
October 04 2013 19:19 GMT
#317
avilo being featured makes me Kreygasm
"You may say I'm a dreamer, but I'm not the only one"
ReachTheSky
Profile Joined April 2010
United States3294 Posts
October 05 2013 01:02 GMT
#318
Congratz on getting featured! You deserve it! Keep up the hard work
TL+ Member
mythandier
Profile Joined January 2011
United States828 Posts
Last Edited: 2013-10-05 01:20:48
October 05 2013 01:20 GMT
#319
Congrats on getting featured =)

Terran streamers hard to come by these days.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
October 05 2013 03:04 GMT
#320
YEEEEHAWWW!! OMG YOU'RE FEATURED!!! I KNEW they'd feature you! It was impossible for them to not feature you! It was only a matter of time before they saw through all the hate. And what they saw was a player with a fun, unique, and innovative style of play; a player who is NOT afraid to speak his mind, even if it gets him hate, and a player who has the BEST twitch.tv stream chat EVER!

If I were with you, Avilo, I'd buy you a huge party-sized bag of peanut-butter M&Ms to celebrate! I'd also get you a beer :D

Congrats, my friend! You have most definitely earned it!
Procrastination is the enemy
lamprey1
Profile Joined June 2012
Canada919 Posts
October 06 2013 17:44 GMT
#321
congratz on being featured.

MMA seems to have no problem beating Protoss.
your expert-level explanation on how this happened would make for a great show on your steam.
isaachukfan
Profile Blog Joined October 2011
Canada785 Posts
October 08 2013 20:15 GMT
#322
I missed the end of the match vs idra yesterday...did our hero manage to take the game?
I'm a mennonite, yes I'm allowed to use a computer
RaZorwire
Profile Joined April 2012
Sweden718 Posts
Last Edited: 2013-10-08 22:14:00
October 08 2013 22:05 GMT
#323
On October 09 2013 05:15 isaachukfan wrote:
I missed the end of the match vs idra yesterday...did our hero manage to take the game?


Depends on who you refer to as the "hero", of course. But Avilo won, if that's what you mean.

Really cool game btw, very back and forth. I am happy Avilo took it in the end, but it looked like it could have gone either way for a while.
dvorakftw
Profile Blog Joined November 2011
681 Posts
October 08 2013 22:29 GMT
#324
On October 09 2013 05:15 isaachukfan wrote:
I missed the end of the match vs idra yesterday...did our hero manage to take the game?

http://www.twitch.tv/avilo/c/3049629
PanN
Profile Blog Joined December 2008
United States2828 Posts
October 09 2013 21:51 GMT
#325
seeing your game vs destiny was priceless !
We have multiple brackets generated in advance. Relax . (Kennigit) I just simply do not understand how it can be the time to play can be 22nd at 9:30 pm PST / midnight the 23rd at the same time. (GGzerg)
dvorakftw
Profile Blog Joined November 2011
681 Posts
October 09 2013 22:03 GMT
#326
Wait did they get matched up or are you mistaking that 2hr game Destiny did against someone who only knew the first half of avilo-style?
Kalfos
Profile Joined March 2013
Dominican Republic34 Posts
October 10 2013 03:35 GMT
#327
Wait did they get matched up or are you mistaking that 2hr game Destiny did against someone who only knew the first half of avilo-style?


Nah it was someone else. He had seen Avilo's style but didn't know how to execute it correctly.
PanN
Profile Blog Joined December 2008
United States2828 Posts
Last Edited: 2013-10-10 04:33:41
October 10 2013 04:32 GMT
#328
On October 10 2013 07:03 dvorakftw wrote:
Wait did they get matched up or are you mistaking that 2hr game Destiny did against someone who only knew the first half of avilo-style?


Avilo made fun of how destiny plays vs mech with that 2hr game, and destiny played avilo today and beat his mech with muta ling.

it was hilarious
We have multiple brackets generated in advance. Relax . (Kennigit) I just simply do not understand how it can be the time to play can be 22nd at 9:30 pm PST / midnight the 23rd at the same time. (GGzerg)
arkanSC79
Profile Joined October 2013
1 Post
October 11 2013 03:24 GMT
#329
On October 10 2013 13:32 PanN wrote:
Show nested quote +
On October 10 2013 07:03 dvorakftw wrote:
Wait did they get matched up or are you mistaking that 2hr game Destiny did against someone who only knew the first half of avilo-style?


Avilo made fun of how destiny plays vs mech with that 2hr game, and destiny played avilo today and beat his mech with muta ling.

it was hilarious


He also deleted the post after Destiny clowned him that game.
Arkansassy
Profile Joined October 2010
358 Posts
October 11 2013 19:20 GMT
#330
@Pan and arkanSC79, apparently you guys don't realize that this thread is for fans. lol

I have no idea how avilo "made fun" of destiny, but I'm sure you interpreted it the way you wanted to. Avilo has always liked Destiny, but maybe to avilo the way destiny plays v mech is humorous. We all see things differently.

As far as a "post" I have no idea what you're talking about, arkanSC79 (with one post) I don't see any posts here that avilo deleted, but so happy that avilo brought you to TL as a newly registered member. :D

The bottom line is there are a lot of people who feel the way you do, and there are many others who don't. Bless your hearts.

codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2013-10-12 03:33:39
October 12 2013 03:17 GMT
#331
**BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** ** BREAKING NEWS** **BREAKING NEWS**
Okay, so I'm three days late on this, but better late than never! Anyway, here goes:

CLICK HERE TO SEE AVILO STOMPING IDRA INTO AN EXTRA CRISPY ZERG-FLAVORED PANCAKE!

OMG OMG OMG OMG OMG YAAAAY HOLY SHIT GUYS! YOU HEARD IT RIGHT! AVILO STOMPED IDRA IN A SUPER-DUPER-PUPER LONG-ASS AVILO MECH GAME! That's right, guys. Idra, who looks down on Avilo and constantly trash-talks him, not to mention his part in the little incident on SotG, has been STOMPED FLAT by the awesome power of Avilo's mech army!!! Check out the game NOW!! AND I MEAN NOW!! DO NOT CLICK AWAY FROM HERE BEFORE YOU CLICK ON THE ABOVE LINK!! I MEAN IT!! SERIOUSLY!! CHECK IT OUT!!!

CLICK HERE TO SEE AVILO STOMPING IDRA INTO AN EXTRA CRISPY ZERG-FLAVORED PANCAKE!

I know I already linked it at the top, but I'm so excited THAT IMA LINK IT TWICE AAAAAAAAUUUUUUUUUGGGHAAAAAA!!!!!!! AND I'M EATING A MILLION BILLION GAJILLION BUTTERFINGERS BECAUSE BUTTERFINGER MOST OP UNIT EVER!!!

Edit: AAAUUUUAAAGAAAAA AAAUUUUUUUUUAAAAGAAAAA!! YAABIDABIDOOOOBEEEEDOOOOOOO!!!!!

Edit 2: *Codonbyte takes off his pants in excitement*
Procrastination is the enemy
TT1
Profile Blog Joined December 2008
Canada10035 Posts
October 12 2013 08:21 GMT
#332
gg, it was an honor to battle against the mighty NA god
ab = tl(i) + tl(pc), the grand answer to every tl.net debate
mantequilla
Profile Blog Joined June 2012
Turkey781 Posts
October 12 2013 08:51 GMT
#333
What's avilo's gear? Mouse specifically.
Age of Mythology forever!
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2013-10-12 19:15:29
October 12 2013 19:10 GMT
#334
He uses all Razer gear.

Mouse, Lachesis
Keyboard, Lycosa
Headset, Carcharais

Please note that his new keyboard broke and he had to go back to his old one, but it's still Lycosa. The new headset broke, too. He's now using the old Razer, Electra, which hurts his ears something fierce. lol
SnowAngel
Profile Joined January 2012
Finland38 Posts
October 13 2013 01:01 GMT
#335
Havent watched sc2 streams so intensively for long time. Hes like goody, but with APM and multitask abilities. I love it. Sign me up :3
dvorakftw
Profile Blog Joined November 2011
681 Posts
October 14 2013 14:53 GMT
#336
On October 12 2013 04:20 Arkansassy wrote:
@Pan and arkanSC79, apparently you guys don't realize that this thread is for fans. lol

I have no idea how avilo "made fun" of destiny, but I'm sure you interpreted it the way you wanted to. Avilo has always liked Destiny, but maybe to avilo the way destiny plays v mech is humorous. We all see things differently.

As far as a "post" I have no idea what you're talking about, arkanSC79 (with one post) I don't see any posts here that avilo deleted, but so happy that avilo brought you to TL as a newly registered member. :D

I think maybe it was a tweet? Anyway the issue was the game Destiny did vs a Terran turtle and the comments from avilo on stream (I never saw the supposed deleted post) were that instead of seeing what we know as "avilo's mid-game" the game went another hour and a half with neither player knowing what to do next.

It had nothing to do with how Destiny meta'd avilo in their game.
Meldrath
Profile Joined June 2010
United States620 Posts
October 24 2013 02:59 GMT
#337
Add me to the ranks... let mech it happen
slap me I must be dreaming another "imba" arugment! fffffffffuuuuuuuuuuuuu!!!!!
lamprey1
Profile Joined June 2012
Canada919 Posts
October 27 2013 20:29 GMT
#338
On October 13 2013 10:01 SnowAngel wrote:
Hes like goody, but with APM and multitask abilities.


Goody has rolled him every game i've seen.
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2013-10-29 23:24:41
October 29 2013 23:24 GMT
#339
Avilo, sir.

C&C got cancelled.
AGMLauncher lost his job at "Victory Games".

I predict your twitch stream and your threads on this site generate more "traffic/activty" than the entire GR.Org site next year.
And, I can't believe i'm predicting this.
But, you definitely deserve it.

I'd like to close this post by borrowing a quote from a great Terran player who can express himself in ways that us platinum-leaguers simply can not.

"Fuck Protoss"


Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
avilo
Profile Blog Joined November 2007
United States4100 Posts
October 30 2013 00:45 GMT
#340
On October 30 2013 08:24 JimmyJRaynor wrote:
Avilo, sir.

C&C got cancelled.
AGMLauncher lost his job at "Victory Games".

I predict your twitch stream and your threads on this site generate more "traffic/activty" than the entire GR.Org site next year.
And, I can't believe i'm predicting this.
But, you definitely deserve it.

I'd like to close this post by borrowing a quote from a great Terran player who can express himself in ways that us platinum-leaguers simply can not.

"Fuck Protoss"




Yes, I just read that this morning. Feels like a long lost relative just died lol That's messed up. Hopefully they are not going to just stop developing the game @_@ i was looking forward to Gens 2 like a lot of RTS fanatics. Are they going to restart development of it?
Sup
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2013-10-30 13:46:28
October 30 2013 13:17 GMT
#341
the entire "Victory Games" studio that was making the game has been closed.
No one knows what is going on as far as "restarting development".
Sad Stuff.

Now, I'll spend ZERO time in the C&C alpha and i can spend more time watching your stream.
At least its guaranteed entertainment. unlike the C&C Alpha.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
codonbyte
Profile Blog Joined June 2011
United States840 Posts
November 01 2013 00:04 GMT
#342
**BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS**

OMG OMG OMG GUYS GUYS GUYS!!! LET IT BE KNOWN THAT AT ABOUT 7:50PM ON THE 31ST OF OCTOBER (HALLOWEEN) OF THE YEAR 2013, DAVID "AVILO" BLOWE DEMOLISHED INCONTROL USING MECH!!!!!!

In an epic game lasting over an hour, Avilo beat every vile protoss mech-killing thing: chargelots, blink stalkers, immortals, and finally a super-late-game protoss army of tempest HT and a few carriers! More details will be added shortly.
Procrastination is the enemy
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
November 01 2013 00:18 GMT
#343
i wore my "Fuck Protoss" hat today...
when people said "what the hell is that" ...
i reply... "i'm going out on Halloween as Avilo"... "you don't know who that is?"
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
fried_rice
Profile Blog Joined July 2013
198 Posts
November 01 2013 01:16 GMT
#344
On November 01 2013 09:04 codonbyte wrote:
**BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS**

OMG OMG OMG GUYS GUYS GUYS!!! LET IT BE KNOWN THAT AT ABOUT 7:50PM ON THE 31ST OF OCTOBER (HALLOWEEN) OF THE YEAR 2013, DAVID "AVILO" BLOWE DEMOLISHED INCONTROL USING MECH!!!!!!

In an epic game lasting over an hour, Avilo beat every vile protoss mech-killing thing: chargelots, blink stalkers, immortals, and finally a super-late-game protoss army of tempest HT and a few carriers! More details will be added shortly.


I saw this, it was badass. I don't think it lasted over an hour though, I might be mistaken.
Psychobabas
Profile Blog Joined March 2006
2531 Posts
November 01 2013 03:37 GMT
#345
On November 01 2013 09:04 codonbyte wrote:
**BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS**

OMG OMG OMG GUYS GUYS GUYS!!! LET IT BE KNOWN THAT AT ABOUT 7:50PM ON THE 31ST OF OCTOBER (HALLOWEEN) OF THE YEAR 2013, DAVID "AVILO" BLOWE DEMOLISHED INCONTROL USING MECH!!!!!!

In an epic game lasting over an hour, Avilo beat every vile protoss mech-killing thing: chargelots, blink stalkers, immortals, and finally a super-late-game protoss army of tempest HT and a few carriers! More details will be added shortly.


Can you post replay please?
ZaMa
Profile Joined August 2013
United States38 Posts
November 01 2013 04:02 GMT
#346
On November 01 2013 09:04 codonbyte wrote:
**BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS** **BREAKING NEWS**

OMG OMG OMG GUYS GUYS GUYS!!! LET IT BE KNOWN THAT AT ABOUT 7:50PM ON THE 31ST OF OCTOBER (HALLOWEEN) OF THE YEAR 2013, DAVID "AVILO" BLOWE DEMOLISHED INCONTROL USING MECH!!!!!!

In an epic game lasting over an hour, Avilo beat every vile protoss mech-killing thing: chargelots, blink stalkers, immortals, and finally a super-late-game protoss army of tempest HT and a few carriers! More details will be added shortly.

lol ily Codon, will watch vod for this ^^
Sherlock117
Profile Joined April 2013
United States40 Posts
Last Edited: 2013-11-01 04:41:55
November 01 2013 04:29 GMT
#347
Avilo, will you be trying to get into the Lake Charles Scion Thanksgiving Open? I know it would be a bit of a trip, but it would be a good opportunity to play some top American players, especially now that you are figuring out mechvP. You were saying on your stream a while ago how there's not a lot of opportunities for North Americans with the WCS system this year. Seems like November and December is stacked with opportunities now!

Edit: They are offering travel support if you make it to the round of 16
andrenyheim85
Profile Joined March 2011
11 Posts
November 01 2013 20:46 GMT
#348
Are there any special stream chat rule for his stream? first time I tried to say anything in chat I got banned for over 40k seconds. Is it sub only or some other secrets? Unable to compliment his creative and super manly play, feel it has to be given credit to anybody exploring mech instead of following the herd like blind sheep. Will definetly watch his stream regardless of ban.
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2013-11-01 20:59:07
November 01 2013 20:57 GMT
#349
On November 02 2013 05:46 andrenyheim85 wrote:
Are there any special stream chat rule for his stream? first time I tried to say anything in chat I got banned for over 40k seconds. Is it sub only or some other secrets? Unable to compliment his creative and super manly play, feel it has to be given credit to anybody exploring mech instead of following the herd like blind sheep. Will definetly watch his stream regardless of ban.


The chat rules are posted regularly, Andrenyheim; however, in some instances an innocent party is timed out when the chat moves too quickly. Time out is supposed to be for 60 seconds, don't know why you got 40K - that's outrageous.

Message me on Twitch with your chat name and I will unban you.

We appreciate your viewership and thank you for letting us know of this error.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
November 03 2013 01:15 GMT
#350
I believe the bot also auto-TO's for certain phrases. Either trumpet or gawdsed (or both) are able to set what those phrases are, and I know they typically set them to phrases that spambots are using (i.e. vine 4 u).
Procrastination is the enemy
inc595
Profile Joined November 2013
United States1 Post
November 10 2013 05:14 GMT
#351
Sign me up codon
Never attribute to malice that which is adequately explained by stupidity.
PanN
Profile Blog Joined December 2008
United States2828 Posts
Last Edited: 2013-11-11 01:36:23
November 11 2013 01:34 GMT
#352
Be careful who you're calling cheaters man. Your stream has a lot of viewers and with that comes some sort of responsibility yo. I hear you call people cheaters a lot, and yeah, they may have sniped you, but it doesn't mean they're cheating.
We have multiple brackets generated in advance. Relax . (Kennigit) I just simply do not understand how it can be the time to play can be 22nd at 9:30 pm PST / midnight the 23rd at the same time. (GGzerg)
starslayer
Profile Joined August 2011
United States696 Posts
Last Edited: 2013-11-11 08:57:40
November 11 2013 04:33 GMT
#353
edit NVM
i came here to kickass and chew bubblegum and i'm all out of bubble gum
Arkansassy
Profile Joined October 2010
358 Posts
November 11 2013 19:22 GMT
#354
On November 11 2013 10:34 PanN wrote:
Be careful who you're calling cheaters man. Your stream has a lot of viewers and with that comes some sort of responsibility yo. I hear you call people cheaters a lot, and yeah, they may have sniped you, but it doesn't mean they're cheating.


Please go read my response to your comment here: http://www.teamliquid.net/forum/viewmessage.php?topic_id=181166&currentpage=38#743
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
November 12 2013 00:37 GMT
#355
if i could make a small suggestion:

a Terran Mech Launch Party on the night Blizzard issues the patch that Buffs the Tank.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
PanN
Profile Blog Joined December 2008
United States2828 Posts
Last Edited: 2013-11-12 00:56:12
November 12 2013 00:49 GMT
#356
On November 12 2013 04:22 Arkansassy wrote:
Show nested quote +
On November 11 2013 10:34 PanN wrote:
Be careful who you're calling cheaters man. Your stream has a lot of viewers and with that comes some sort of responsibility yo. I hear you call people cheaters a lot, and yeah, they may have sniped you, but it doesn't mean they're cheating.


Please go read my response to your comment here: http://www.teamliquid.net/forum/viewmessage.php?topic_id=181166&currentpage=38#743


Can you read what I just wrote then? Dude calls out multiple people as cheaters without having concrete evidence. He has an innate responsibility when it comes to spreading information, and calling people out as cheaters when they simply sniped him is not fair to those people.

He's a streamer, a popular one, he's going to get sniped often, it doesn't mean they're cheaters. I was watching last night and he called out someone as a cheater, when they weren't showing any signs of it what so ever, no involvement in the chat, and no comments in game. Pretend this guy gets called a cheater often now because of how avilo called him out, how exactly is that fair to the individual? It's not fair, it's not fair at all.

I get it though, I understand that he gets frustrated, I understand that he plays a lot of cheating assholes, but that doesn't change a single thing that I said. He should be careful as a popular streamer as to who he calls out.
We have multiple brackets generated in advance. Relax . (Kennigit) I just simply do not understand how it can be the time to play can be 22nd at 9:30 pm PST / midnight the 23rd at the same time. (GGzerg)
Arkansassy
Profile Joined October 2010
358 Posts
November 12 2013 02:13 GMT
#357
Actually, PanN, I'm quite literate and have relatively good comprehension skills. I understood completely what you said in your first comment and that's why I referred you to my link.
Kevin_Sorbo
Profile Joined November 2011
Canada3217 Posts
November 12 2013 05:14 GMT
#358
"For LOTV : 5 m strat : Marine Marauder Medivac Mine Motherfucker.''

Avilo 2013
The mind is like a parachute, it doesnt work unless its open. - Zappa
dvorakftw
Profile Blog Joined November 2011
681 Posts
November 19 2013 10:05 GMT
#359
On November 12 2013 09:37 JimmyJRaynor wrote:
if i could make a small suggestion:

a Terran Mech Launch Party on the night Blizzard issues the patch that Buffs the Tank.

I think we'll be waiting a long time for a tank buff worth celebrating.
lokes
Profile Blog Joined November 2011
Argentina80 Posts
November 29 2013 06:45 GMT
#360
lol idra could get gm in korea easily
dvorakftw
Profile Blog Joined November 2011
681 Posts
January 01 2014 16:15 GMT
#361
Note to self: Promote the fanclub more.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
January 02 2014 00:05 GMT
#362
On November 12 2013 09:49 PanN wrote:
Show nested quote +
On November 12 2013 04:22 Arkansassy wrote:
On November 11 2013 10:34 PanN wrote:
Be careful who you're calling cheaters man. Your stream has a lot of viewers and with that comes some sort of responsibility yo. I hear you call people cheaters a lot, and yeah, they may have sniped you, but it doesn't mean they're cheating.


Please go read my response to your comment here: http://www.teamliquid.net/forum/viewmessage.php?topic_id=181166&currentpage=38#743


Can you read what I just wrote then? Dude calls out multiple people as cheaters without having concrete evidence. He has an innate responsibility when it comes to spreading information, and calling people out as cheaters when they simply sniped him is not fair to those people.

He's a streamer, a popular one, he's going to get sniped often, it doesn't mean they're cheaters. I was watching last night and he called out someone as a cheater, when they weren't showing any signs of it what so ever, no involvement in the chat, and no comments in game. Pretend this guy gets called a cheater often now because of how avilo called him out, how exactly is that fair to the individual? It's not fair, it's not fair at all.

I get it though, I understand that he gets frustrated, I understand that he plays a lot of cheating assholes, but that doesn't change a single thing that I said. He should be careful as a popular streamer as to who he calls out.

Actually, many people would disagree with you there. Many people consider stream sniping to be cheating on it's own, even if you close the stream immediately. You're cheating the matchmaking system, which is designed to match you up with a RANDOM OPPONENT, i.e. not one who tried to get matched up with you.
Procrastination is the enemy
Mantaza
Profile Joined January 2011
Germany87 Posts
January 02 2014 00:20 GMT
#363
i dont get why people support a player whos only toxic to the community.
Making hate speeches to entire races flames other pro players and then loses like shit to miniguns terran.
He cant even make his point about protoss being broken ( i can make it into masters in 1day---> 2days later diamond) he loses to minigun and that not even close no but 4-1 if its so broken then freakin abuse all the broken shit but i guess its not only a move.
Back when he played beastyqt and beasty flamed him about his style i actually was on avilos side or when he was on state of the game and idra flamed him for no apparent reason but now hes abusing his viewer count to make the community like him a toxic trashtalker who doesnt even want to improve.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2014-01-02 00:29:21
January 02 2014 00:27 GMT
#364
On November 19 2013 19:05 dvorakftw wrote:
Show nested quote +
On November 12 2013 09:37 JimmyJRaynor wrote:
if i could make a small suggestion:

a Terran Mech Launch Party on the night Blizzard issues the patch that Buffs the Tank.

I think we'll be waiting a long time for a tank buff worth celebrating.

If DK gets fired, we'll definitely hold a terran mech launch party. It will be HUGE. and this song will be playing:


Procrastination is the enemy
PanN
Profile Blog Joined December 2008
United States2828 Posts
Last Edited: 2014-01-02 02:01:07
January 02 2014 01:56 GMT
#365
On January 02 2014 09:05 codonbyte wrote:
Show nested quote +
On November 12 2013 09:49 PanN wrote:
On November 12 2013 04:22 Arkansassy wrote:
On November 11 2013 10:34 PanN wrote:
Be careful who you're calling cheaters man. Your stream has a lot of viewers and with that comes some sort of responsibility yo. I hear you call people cheaters a lot, and yeah, they may have sniped you, but it doesn't mean they're cheating.


Please go read my response to your comment here: http://www.teamliquid.net/forum/viewmessage.php?topic_id=181166&currentpage=38#743


Can you read what I just wrote then? Dude calls out multiple people as cheaters without having concrete evidence. He has an innate responsibility when it comes to spreading information, and calling people out as cheaters when they simply sniped him is not fair to those people.

He's a streamer, a popular one, he's going to get sniped often, it doesn't mean they're cheaters. I was watching last night and he called out someone as a cheater, when they weren't showing any signs of it what so ever, no involvement in the chat, and no comments in game. Pretend this guy gets called a cheater often now because of how avilo called him out, how exactly is that fair to the individual? It's not fair, it's not fair at all.

I get it though, I understand that he gets frustrated, I understand that he plays a lot of cheating assholes, but that doesn't change a single thing that I said. He should be careful as a popular streamer as to who he calls out.

Actually, many people would disagree with you there. Many people consider stream sniping to be cheating on it's own, even if you close the stream immediately. You're cheating the matchmaking system, which is designed to match you up with a RANDOM OPPONENT, i.e. not one who tried to get matched up with you.


I really doubt avilo was calling people out for cheating the system when I was talking about this. Your entire post is just unnecessary and I get what you're saying, but if you read my post and picked up on the context of me discussing cheaters, you clearly would have understood that I was talking about people committing the act of looking at his stream hence stream cheating. Why nit pick about something so silly, I agree that in a sense its cheating the system, but thats clearly not what I was discussing, and I'm pretty sure avilo wasn't saying in his head "grr these guys sniped me! they went around the original match making system to get matched vs me, these cheaters!" I'm pretty sure it was more along the lines of "oh this guy got matched vs me again, he sniped me and now he's going to watch my stream while we play this whole match essentially map hacking."

This is why there is stream cheating, and stream sniping. Both different, i was discussing them and the way avilo talked about it. Not that I even care anymore I haven't heard him do it in a long time which is awesome. Also you responded to a post of mine from november 12. If it was that interesting just pm me or something, not discussing it anymore.
We have multiple brackets generated in advance. Relax . (Kennigit) I just simply do not understand how it can be the time to play can be 22nd at 9:30 pm PST / midnight the 23rd at the same time. (GGzerg)
blade55555
Profile Blog Joined March 2009
United States17423 Posts
January 02 2014 02:18 GMT
#366
On January 02 2014 10:56 PanN wrote:
Show nested quote +
On January 02 2014 09:05 codonbyte wrote:
On November 12 2013 09:49 PanN wrote:
On November 12 2013 04:22 Arkansassy wrote:
On November 11 2013 10:34 PanN wrote:
Be careful who you're calling cheaters man. Your stream has a lot of viewers and with that comes some sort of responsibility yo. I hear you call people cheaters a lot, and yeah, they may have sniped you, but it doesn't mean they're cheating.


Please go read my response to your comment here: http://www.teamliquid.net/forum/viewmessage.php?topic_id=181166&currentpage=38#743


Can you read what I just wrote then? Dude calls out multiple people as cheaters without having concrete evidence. He has an innate responsibility when it comes to spreading information, and calling people out as cheaters when they simply sniped him is not fair to those people.

He's a streamer, a popular one, he's going to get sniped often, it doesn't mean they're cheaters. I was watching last night and he called out someone as a cheater, when they weren't showing any signs of it what so ever, no involvement in the chat, and no comments in game. Pretend this guy gets called a cheater often now because of how avilo called him out, how exactly is that fair to the individual? It's not fair, it's not fair at all.

I get it though, I understand that he gets frustrated, I understand that he plays a lot of cheating assholes, but that doesn't change a single thing that I said. He should be careful as a popular streamer as to who he calls out.

Actually, many people would disagree with you there. Many people consider stream sniping to be cheating on it's own, even if you close the stream immediately. You're cheating the matchmaking system, which is designed to match you up with a RANDOM OPPONENT, i.e. not one who tried to get matched up with you.


I really doubt avilo was calling people out for cheating the system when I was talking about this. Your entire post is just unnecessary and I get what you're saying, but if you read my post and picked up on the context of me discussing cheaters, you clearly would have understood that I was talking about people committing the act of looking at his stream hence stream cheating. Why nit pick about something so silly, I agree that in a sense its cheating the system, but thats clearly not what I was discussing, and I'm pretty sure avilo wasn't saying in his head "grr these guys sniped me! they went around the original match making system to get matched vs me, these cheaters!" I'm pretty sure it was more along the lines of "oh this guy got matched vs me again, he sniped me and now he's going to watch my stream while we play this whole match essentially map hacking."

This is why there is stream cheating, and stream sniping. Both different, i was discussing them and the way avilo talked about it. Not that I even care anymore I haven't heard him do it in a long time which is awesome. Also you responded to a post of mine from november 12. If it was that interesting just pm me or something, not discussing it anymore.


He still does it all the time. Just 1-2 days ago he accused minigun (who was on a barcode) of map hacking/stream cheating and both of them were streaming when he got rolled.
When I think of something else, something will go here
avilo
Profile Blog Joined November 2007
United States4100 Posts
January 02 2014 04:33 GMT
#367
On January 02 2014 11:18 blade55555 wrote:
Show nested quote +
On January 02 2014 10:56 PanN wrote:
On January 02 2014 09:05 codonbyte wrote:
On November 12 2013 09:49 PanN wrote:
On November 12 2013 04:22 Arkansassy wrote:
On November 11 2013 10:34 PanN wrote:
Be careful who you're calling cheaters man. Your stream has a lot of viewers and with that comes some sort of responsibility yo. I hear you call people cheaters a lot, and yeah, they may have sniped you, but it doesn't mean they're cheating.


Please go read my response to your comment here: http://www.teamliquid.net/forum/viewmessage.php?topic_id=181166&currentpage=38#743


Can you read what I just wrote then? Dude calls out multiple people as cheaters without having concrete evidence. He has an innate responsibility when it comes to spreading information, and calling people out as cheaters when they simply sniped him is not fair to those people.

He's a streamer, a popular one, he's going to get sniped often, it doesn't mean they're cheaters. I was watching last night and he called out someone as a cheater, when they weren't showing any signs of it what so ever, no involvement in the chat, and no comments in game. Pretend this guy gets called a cheater often now because of how avilo called him out, how exactly is that fair to the individual? It's not fair, it's not fair at all.

I get it though, I understand that he gets frustrated, I understand that he plays a lot of cheating assholes, but that doesn't change a single thing that I said. He should be careful as a popular streamer as to who he calls out.

Actually, many people would disagree with you there. Many people consider stream sniping to be cheating on it's own, even if you close the stream immediately. You're cheating the matchmaking system, which is designed to match you up with a RANDOM OPPONENT, i.e. not one who tried to get matched up with you.


I really doubt avilo was calling people out for cheating the system when I was talking about this. Your entire post is just unnecessary and I get what you're saying, but if you read my post and picked up on the context of me discussing cheaters, you clearly would have understood that I was talking about people committing the act of looking at his stream hence stream cheating. Why nit pick about something so silly, I agree that in a sense its cheating the system, but thats clearly not what I was discussing, and I'm pretty sure avilo wasn't saying in his head "grr these guys sniped me! they went around the original match making system to get matched vs me, these cheaters!" I'm pretty sure it was more along the lines of "oh this guy got matched vs me again, he sniped me and now he's going to watch my stream while we play this whole match essentially map hacking."

This is why there is stream cheating, and stream sniping. Both different, i was discussing them and the way avilo talked about it. Not that I even care anymore I haven't heard him do it in a long time which is awesome. Also you responded to a post of mine from november 12. If it was that interesting just pm me or something, not discussing it anymore.


He still does it all the time. Just 1-2 days ago he accused minigun (who was on a barcode) of map hacking/stream cheating and both of them were streaming when he got rolled.


Haha, always a 1 sided story from the avilo haters.

The amount of stream snipers i have gotten in the past is ridiculous. There are also a few known "pros" that have sniped me as well, of course metagaming the shit out of me while on their barcode when i have no idea who they are, and to any objective viewer it would look like they were stream sniping/cheating, when in actuality they were on my stream prior waiting for me to queue up and then they just metagame me.

I've had a few known players do that to me - and then they have the audacity to get in my chat and act like an innoncent angel and be like, "omg how could you accuse me of cheating dude!" Because of course people then will do what you are trying to do and start up the hate bandwagon.

Always two sides to the story.
Sup
Mantaza
Profile Joined January 2011
Germany87 Posts
January 02 2014 12:42 GMT
#368
soo you say minigun stream sniped so even tho he was just normally queing after the game before ?
I understand that as a known streamer you get a lot sniped but in this case it was just silly.
Arkansassy
Profile Joined October 2010
358 Posts
January 02 2014 16:46 GMT
#369
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.
captainwaffles
Profile Blog Joined February 2009
United States1050 Posts
January 02 2014 20:49 GMT
#370
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.
https://x.com/CaptainWaffless
Shebuha
Profile Blog Joined May 2011
Canada1335 Posts
January 02 2014 21:58 GMT
#371
On January 03 2014 05:49 captainwaffles wrote:
Show nested quote +
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.

I find it very strange that Avilo's fanbase emphasizes being nice and discourages BM as a whole while proclaiming that Avilo himself doesn't BM -- that he's the victim. That isn't the case though. I've played Avilo on the ladder, lost, and gotten BM'ed. I didn't snipe him, didn't stream cheat, I lost the game. Usually it was a stomp in the super late game and I still get BM'ed or whined at. It's the same when I watch his stream. He can hardly go a game without making a silly claim about balance or what have you whether it's provoked or not.

He brings it on himself indeed.
Mistakes
Profile Joined February 2011
United States1102 Posts
January 02 2014 23:56 GMT
#372
Didn't Avilo play a barcode the other day and complained to Minigun about something? But that barcode was Minigun, and the only way he could've known it was Minigun was by watching his stream?
StarCraft | www.psistorm.com | www.twitter.com/MistakesSC | www.twitch.tv/MistakesSC | Seattle
darthfoley
Profile Blog Joined February 2011
United States8004 Posts
January 03 2014 00:23 GMT
#373
Avilo is an odd character.

I was also apparently one of the people who should die because in my head, I pronouced it aveelo.
watch the wall collide with my fist, mostly over problems that i know i should fix
captainwaffles
Profile Blog Joined February 2009
United States1050 Posts
January 03 2014 00:34 GMT
#374
On January 03 2014 06:58 Shebuha wrote:
Show nested quote +
On January 03 2014 05:49 captainwaffles wrote:
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.

I find it very strange that Avilo's fanbase emphasizes being nice and discourages BM as a whole while proclaiming that Avilo himself doesn't BM -- that he's the victim. That isn't the case though. I've played Avilo on the ladder, lost, and gotten BM'ed. I didn't snipe him, didn't stream cheat, I lost the game. Usually it was a stomp in the super late game and I still get BM'ed or whined at. It's the same when I watch his stream. He can hardly go a game without making a silly claim about balance or what have you whether it's provoked or not.

He brings it on himself indeed.


Theres nothing strange about it, he just a hypocrite. Whats funny about it though is he'll say for example root players "bm him" and pretend to be angels everywhere else and here is doing the same exact thing, bming the fuck out of everyone and then when he gets called out he tries (keyword tries) to spin some kind of BS.
https://x.com/CaptainWaffless
Lyyna
Profile Joined June 2011
France776 Posts
Last Edited: 2014-01-03 02:30:52
January 03 2014 02:14 GMT
#375
The problem with Avilo is that his goals are right, but the ways he's trying to achieve them are awful...
he wants to help terrans to get better with guides and tips and analysis and innovative play, but he's trying to brag and give all credits to himself (may be ironical or not... but what matters is how it is perceived by most people, and this is affected by his overall behavior) whenever someone else does something similar, be it fellow foreigners streamers, or koreans pro in streamed tournaments
He wants to point flaws in balance and the overall game, but ends up talking about it every single hour of the day, tries to prove his ideas with whatever (sometimes unrelated) things he can get his hands on and attributes a lot of his losses to this
He's denouncing the terrible attitude some people have about him, but ends up being as much as a jerk than these people, and making it even worse by often raging and yelling at some random people for whatever reasons
He's trying to get respected and known, but he himself fuel his haters and make it worse by saying "i don't care lol" even when people just want to help him by pointing what makes him hated by a lot.. for some good reasons

You know me Sassy, i have often been on his stream, never offensive or whatever, i'm not an hardcore fan who'll follow him until death, i'm not an hater wanting to burn him right now, i could be considered a rival because i'm in the same "niche" of spreading mech in the community, but well, i'm really just the average guy enjoying the original play of one of the few remaining terran streamers, and i just want to give a realistic insight about this. Avilo could be a really great part of the community : he's someone who dares to try stuff, to speak freely, and who is ok with sharing his knowledge and advices. But for that, he has to shut down his "cocky non-caring-about-criticism bitchy" side, or he'll just be remembered like "that whiner who plays mech and is known because he rages more than Idra and made a couple of funny guides who acts like he's the man who made every single terran metagame evolution happen and sometimes say smart things... covered by a layer of rage"

Take it as you want obviously... Just wanting to help everyone, you, your fans, the community.. But at some point, when so many people tells you the same things again and again and again about your flaws, considering what you want to achieve, you should try to improve yourself instead of just ignoring them, blaming them, or acting like it's totally undeserved
http://www.teamliquid.net/forum/sc2-strategy/459600-how-to-mech-them-cry-lyynas-mech-in-hots - The 2014 Mech guide ! http://www.twitch.tv/lyyna for stream and contact infos
avilo
Profile Blog Joined November 2007
United States4100 Posts
Last Edited: 2014-01-03 03:24:03
January 03 2014 03:16 GMT
#376
On January 03 2014 09:34 captainwaffles wrote:
Show nested quote +
On January 03 2014 06:58 Shebuha wrote:
On January 03 2014 05:49 captainwaffles wrote:
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.

I find it very strange that Avilo's fanbase emphasizes being nice and discourages BM as a whole while proclaiming that Avilo himself doesn't BM -- that he's the victim. That isn't the case though. I've played Avilo on the ladder, lost, and gotten BM'ed. I didn't snipe him, didn't stream cheat, I lost the game. Usually it was a stomp in the super late game and I still get BM'ed or whined at. It's the same when I watch his stream. He can hardly go a game without making a silly claim about balance or what have you whether it's provoked or not.

He brings it on himself indeed.


Theres nothing strange about it, he just a hypocrite. Whats funny about it though is he'll say for example root players "bm him" and pretend to be angels everywhere else and here is doing the same exact thing, bming the fuck out of everyone and then when he gets called out he tries (keyword tries) to spin some kind of BS.


Oh you must have seen the game where i played a rootseed player and they thought it was perfectly acceptable to just insta unpause the game because it's "avilo." There are some people that think it's perfectly ok to BM me just because other people in the community do it, then they do it too because it's trendy or some shiot.

The difference is if I BM someone on ladder it's usually in fun and i'm just trolling...and i never personally insult them about who they are. I'll call someone bad every now and then, sure. Or gimmicky. I never insult their own person, nor would i want to.

On January 03 2014 11:14 Lyyna wrote:
The problem with Avilo is that his goals are right, but the ways he's trying to achieve them are awful...
he wants to help terrans to get better with guides and tips and analysis and innovative play, but he's trying to brag and give all credits to himself (may be ironical or not... but what matters is how it is perceived by most people, and this is affected by his overall behavior) whenever someone else does something similar, be it fellow foreigners streamers, or koreans pro in streamed tournaments
He wants to point flaws in balance and the overall game, but ends up talking about it every single hour of the day, tries to prove his ideas with whatever (sometimes unrelated) things he can get his hands on and attributes a lot of his losses to this
He's denouncing the terrible attitude some people have about him, but ends up being as much as a jerk than these people, and making it even worse by often raging and yelling at some random people for whatever reasons
He's trying to get respected and known, but he himself fuel his haters and make it worse by saying "i don't care lol" even when people just want to help him by pointing what makes him hated by a lot.. for some good reasons

You know me Sassy, i have often been on his stream, never offensive or whatever, i'm not an hardcore fan who'll follow him until death, i'm not an hater wanting to burn him right now, i could be considered a rival because i'm in the same "niche" of spreading mech in the community, but well, i'm really just the average guy enjoying the original play of one of the few remaining terran streamers, and i just want to give a realistic insight about this. Avilo could be a really great part of the community : he's someone who dares to try stuff, to speak freely, and who is ok with sharing his knowledge and advices. But for that, he has to shut down his "cocky non-caring-about-criticism bitchy" side, or he'll just be remembered like "that whiner who plays mech and is known because he rages more than Idra and made a couple of funny guides who acts like he's the man who made every single terran metagame evolution happen and sometimes say smart things... covered by a layer of rage"

Take it as you want obviously... Just wanting to help everyone, you, your fans, the community.. But at some point, when so many people tells you the same things again and again and again about your flaws, considering what you want to achieve, you should try to improve yourself instead of just ignoring them, blaming them, or acting like it's totally undeserved


When the majority of games on ladder you end up playing end up being vs Protoss every game abusing all-ins and nexus cannon...it's a bit unavoidable to discuss balance at that point.

On January 03 2014 09:23 darthfoley wrote:
Avilo is an odd character.

I was also apparently one of the people who should die because in my head, I pronouced it aveelo.


lmao :D never would i wish such a thing upon you for mispronouncing my username haha. Thanks for watching the stream

On January 03 2014 05:49 captainwaffles wrote:
Show nested quote +
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.


You are one of the most dedicated avilo haters of late. Get it straight. I do not accuse known pros of stream cheating/hacking ever. You and other little haters continue this BS with no context to the situation.

I have played known players before that were on barcodes metagaming the fuck out of me, and to any outside observer it would look like the guy was stream sniping in some way, and possibly stream cheating. Not my fault i didn't know some d00d sniping me was on a barcode.

If you honestly think i ever accuse known players of cheating, something is wrong with you. I never would.
Sup
captainwaffles
Profile Blog Joined February 2009
United States1050 Posts
January 03 2014 03:45 GMT
#377
On January 03 2014 12:16 avilo wrote:
Show nested quote +
On January 03 2014 09:34 captainwaffles wrote:
On January 03 2014 06:58 Shebuha wrote:
On January 03 2014 05:49 captainwaffles wrote:
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.

I find it very strange that Avilo's fanbase emphasizes being nice and discourages BM as a whole while proclaiming that Avilo himself doesn't BM -- that he's the victim. That isn't the case though. I've played Avilo on the ladder, lost, and gotten BM'ed. I didn't snipe him, didn't stream cheat, I lost the game. Usually it was a stomp in the super late game and I still get BM'ed or whined at. It's the same when I watch his stream. He can hardly go a game without making a silly claim about balance or what have you whether it's provoked or not.

He brings it on himself indeed.


Theres nothing strange about it, he just a hypocrite. Whats funny about it though is he'll say for example root players "bm him" and pretend to be angels everywhere else and here is doing the same exact thing, bming the fuck out of everyone and then when he gets called out he tries (keyword tries) to spin some kind of BS.


Oh you must have seen the game where i played a rootseed player and they thought it was perfectly acceptable to just insta unpause the game because it's "avilo." There are some people that think it's perfectly ok to BM me just because other people in the community do it, then they do it too because it's trendy or some shiot.

The difference is if I BM someone on ladder it's usually in fun and i'm just trolling...and i never personally insult them about who they are. I'll call someone bad every now and then, sure. Or gimmicky. I never insult their own person, nor would i want to.

Show nested quote +
On January 03 2014 11:14 Lyyna wrote:
The problem with Avilo is that his goals are right, but the ways he's trying to achieve them are awful...
he wants to help terrans to get better with guides and tips and analysis and innovative play, but he's trying to brag and give all credits to himself (may be ironical or not... but what matters is how it is perceived by most people, and this is affected by his overall behavior) whenever someone else does something similar, be it fellow foreigners streamers, or koreans pro in streamed tournaments
He wants to point flaws in balance and the overall game, but ends up talking about it every single hour of the day, tries to prove his ideas with whatever (sometimes unrelated) things he can get his hands on and attributes a lot of his losses to this
He's denouncing the terrible attitude some people have about him, but ends up being as much as a jerk than these people, and making it even worse by often raging and yelling at some random people for whatever reasons
He's trying to get respected and known, but he himself fuel his haters and make it worse by saying "i don't care lol" even when people just want to help him by pointing what makes him hated by a lot.. for some good reasons

You know me Sassy, i have often been on his stream, never offensive or whatever, i'm not an hardcore fan who'll follow him until death, i'm not an hater wanting to burn him right now, i could be considered a rival because i'm in the same "niche" of spreading mech in the community, but well, i'm really just the average guy enjoying the original play of one of the few remaining terran streamers, and i just want to give a realistic insight about this. Avilo could be a really great part of the community : he's someone who dares to try stuff, to speak freely, and who is ok with sharing his knowledge and advices. But for that, he has to shut down his "cocky non-caring-about-criticism bitchy" side, or he'll just be remembered like "that whiner who plays mech and is known because he rages more than Idra and made a couple of funny guides who acts like he's the man who made every single terran metagame evolution happen and sometimes say smart things... covered by a layer of rage"

Take it as you want obviously... Just wanting to help everyone, you, your fans, the community.. But at some point, when so many people tells you the same things again and again and again about your flaws, considering what you want to achieve, you should try to improve yourself instead of just ignoring them, blaming them, or acting like it's totally undeserved


When the majority of games on ladder you end up playing end up being vs Protoss every game abusing all-ins and nexus cannon...it's a bit unavoidable to discuss balance at that point.

Show nested quote +
On January 03 2014 09:23 darthfoley wrote:
Avilo is an odd character.

I was also apparently one of the people who should die because in my head, I pronouced it aveelo.


lmao :D never would i wish such a thing upon you for mispronouncing my username haha. Thanks for watching the stream

Show nested quote +
On January 03 2014 05:49 captainwaffles wrote:
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.


You are one of the most dedicated avilo haters of late. Get it straight. I do not accuse known pros of stream cheating/hacking ever. You and other little haters continue this BS with no context to the situation.

I have played known players before that were on barcodes metagaming the fuck out of me, and to any outside observer it would look like the guy was stream sniping in some way, and possibly stream cheating. Not my fault i didn't know some d00d sniping me was on a barcode.

If you honestly think i ever accuse known players of cheating, something is wrong with you. I never would.


This is what me and Lynna were talking about lol. Why would you even quote lynna if you're just going to ignore his constructive criticisms? Unlike me he still thinks theres hope for you I think this post of yours will show him that you are hopeless to become a positive in the scene


You really don't get it you do? I can't believe how dense you are. Your actions alone have warranted any negative actions people do onto you. Simple as that, look in the mirror if you want to find out why people would bm you.

You accuse everyone (Known players, random masters players, etc) of cheating all the time If you're gonna put your head in the sand and deny it and go la la la thats fine don't expect me to put any effort into pulling up examples with timestamps from your VODs.

Tbh I think Kane said it best:

"you have to understand he's not a mentally stable individual. it's completely obvious he has some sort of disability (i.e. autism, aspergers, etc.). You can't take anything he says seriously; no healthy individual would say half the stuff he says."

(source: http://www.reddit.com/r/starcraft/comments/1u4jly/why_is_avilo_so_mean_to_everyone_he_calls/ceefq3x)



https://x.com/CaptainWaffless
avilo
Profile Blog Joined November 2007
United States4100 Posts
January 03 2014 03:56 GMT
#378
On January 03 2014 12:45 captainwaffles wrote:
Show nested quote +
On January 03 2014 12:16 avilo wrote:
On January 03 2014 09:34 captainwaffles wrote:
On January 03 2014 06:58 Shebuha wrote:
On January 03 2014 05:49 captainwaffles wrote:
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.

I find it very strange that Avilo's fanbase emphasizes being nice and discourages BM as a whole while proclaiming that Avilo himself doesn't BM -- that he's the victim. That isn't the case though. I've played Avilo on the ladder, lost, and gotten BM'ed. I didn't snipe him, didn't stream cheat, I lost the game. Usually it was a stomp in the super late game and I still get BM'ed or whined at. It's the same when I watch his stream. He can hardly go a game without making a silly claim about balance or what have you whether it's provoked or not.

He brings it on himself indeed.


Theres nothing strange about it, he just a hypocrite. Whats funny about it though is he'll say for example root players "bm him" and pretend to be angels everywhere else and here is doing the same exact thing, bming the fuck out of everyone and then when he gets called out he tries (keyword tries) to spin some kind of BS.


Oh you must have seen the game where i played a rootseed player and they thought it was perfectly acceptable to just insta unpause the game because it's "avilo." There are some people that think it's perfectly ok to BM me just because other people in the community do it, then they do it too because it's trendy or some shiot.

The difference is if I BM someone on ladder it's usually in fun and i'm just trolling...and i never personally insult them about who they are. I'll call someone bad every now and then, sure. Or gimmicky. I never insult their own person, nor would i want to.

On January 03 2014 11:14 Lyyna wrote:
The problem with Avilo is that his goals are right, but the ways he's trying to achieve them are awful...
he wants to help terrans to get better with guides and tips and analysis and innovative play, but he's trying to brag and give all credits to himself (may be ironical or not... but what matters is how it is perceived by most people, and this is affected by his overall behavior) whenever someone else does something similar, be it fellow foreigners streamers, or koreans pro in streamed tournaments
He wants to point flaws in balance and the overall game, but ends up talking about it every single hour of the day, tries to prove his ideas with whatever (sometimes unrelated) things he can get his hands on and attributes a lot of his losses to this
He's denouncing the terrible attitude some people have about him, but ends up being as much as a jerk than these people, and making it even worse by often raging and yelling at some random people for whatever reasons
He's trying to get respected and known, but he himself fuel his haters and make it worse by saying "i don't care lol" even when people just want to help him by pointing what makes him hated by a lot.. for some good reasons

You know me Sassy, i have often been on his stream, never offensive or whatever, i'm not an hardcore fan who'll follow him until death, i'm not an hater wanting to burn him right now, i could be considered a rival because i'm in the same "niche" of spreading mech in the community, but well, i'm really just the average guy enjoying the original play of one of the few remaining terran streamers, and i just want to give a realistic insight about this. Avilo could be a really great part of the community : he's someone who dares to try stuff, to speak freely, and who is ok with sharing his knowledge and advices. But for that, he has to shut down his "cocky non-caring-about-criticism bitchy" side, or he'll just be remembered like "that whiner who plays mech and is known because he rages more than Idra and made a couple of funny guides who acts like he's the man who made every single terran metagame evolution happen and sometimes say smart things... covered by a layer of rage"

Take it as you want obviously... Just wanting to help everyone, you, your fans, the community.. But at some point, when so many people tells you the same things again and again and again about your flaws, considering what you want to achieve, you should try to improve yourself instead of just ignoring them, blaming them, or acting like it's totally undeserved


When the majority of games on ladder you end up playing end up being vs Protoss every game abusing all-ins and nexus cannon...it's a bit unavoidable to discuss balance at that point.

On January 03 2014 09:23 darthfoley wrote:
Avilo is an odd character.

I was also apparently one of the people who should die because in my head, I pronouced it aveelo.


lmao :D never would i wish such a thing upon you for mispronouncing my username haha. Thanks for watching the stream

On January 03 2014 05:49 captainwaffles wrote:
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.


You are one of the most dedicated avilo haters of late. Get it straight. I do not accuse known pros of stream cheating/hacking ever. You and other little haters continue this BS with no context to the situation.

I have played known players before that were on barcodes metagaming the fuck out of me, and to any outside observer it would look like the guy was stream sniping in some way, and possibly stream cheating. Not my fault i didn't know some d00d sniping me was on a barcode.

If you honestly think i ever accuse known players of cheating, something is wrong with you. I never would.


This is what me and Lynna were talking about lol. Why would you even quote lynna if you're just going to ignore his constructive criticisms? Unlike me he still thinks theres hope for you I think this post of yours will show him that you are hopeless to become a positive in the scene


You really don't get it you do? I can't believe how dense you are. Your actions alone have warranted any negative actions people do onto you. Simple as that, look in the mirror if you want to find out why people would bm you.

You accuse everyone (Known players, random masters players, etc) of cheating all the time If you're gonna put your head in the sand and deny it and go la la la thats fine don't expect me to put any effort into pulling up examples with timestamps from your VODs.

Tbh I think Kane said it best:

"you have to understand he's not a mentally stable individual. it's completely obvious he has some sort of disability (i.e. autism, aspergers, etc.). You can't take anything he says seriously; no healthy individual would say half the stuff he says."

(source: http://www.reddit.com/r/starcraft/comments/1u4jly/why_is_avilo_so_mean_to_everyone_he_calls/ceefq3x)


Not going to respond to you anymore, except with: You need to go to jelly school, immediately.
Sup
captainwaffles
Profile Blog Joined February 2009
United States1050 Posts
January 03 2014 04:13 GMT
#379
On January 03 2014 12:56 avilo wrote:
Show nested quote +
On January 03 2014 12:45 captainwaffles wrote:
On January 03 2014 12:16 avilo wrote:
On January 03 2014 09:34 captainwaffles wrote:
On January 03 2014 06:58 Shebuha wrote:
On January 03 2014 05:49 captainwaffles wrote:
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.

I find it very strange that Avilo's fanbase emphasizes being nice and discourages BM as a whole while proclaiming that Avilo himself doesn't BM -- that he's the victim. That isn't the case though. I've played Avilo on the ladder, lost, and gotten BM'ed. I didn't snipe him, didn't stream cheat, I lost the game. Usually it was a stomp in the super late game and I still get BM'ed or whined at. It's the same when I watch his stream. He can hardly go a game without making a silly claim about balance or what have you whether it's provoked or not.

He brings it on himself indeed.


Theres nothing strange about it, he just a hypocrite. Whats funny about it though is he'll say for example root players "bm him" and pretend to be angels everywhere else and here is doing the same exact thing, bming the fuck out of everyone and then when he gets called out he tries (keyword tries) to spin some kind of BS.


Oh you must have seen the game where i played a rootseed player and they thought it was perfectly acceptable to just insta unpause the game because it's "avilo." There are some people that think it's perfectly ok to BM me just because other people in the community do it, then they do it too because it's trendy or some shiot.

The difference is if I BM someone on ladder it's usually in fun and i'm just trolling...and i never personally insult them about who they are. I'll call someone bad every now and then, sure. Or gimmicky. I never insult their own person, nor would i want to.

On January 03 2014 11:14 Lyyna wrote:
The problem with Avilo is that his goals are right, but the ways he's trying to achieve them are awful...
he wants to help terrans to get better with guides and tips and analysis and innovative play, but he's trying to brag and give all credits to himself (may be ironical or not... but what matters is how it is perceived by most people, and this is affected by his overall behavior) whenever someone else does something similar, be it fellow foreigners streamers, or koreans pro in streamed tournaments
He wants to point flaws in balance and the overall game, but ends up talking about it every single hour of the day, tries to prove his ideas with whatever (sometimes unrelated) things he can get his hands on and attributes a lot of his losses to this
He's denouncing the terrible attitude some people have about him, but ends up being as much as a jerk than these people, and making it even worse by often raging and yelling at some random people for whatever reasons
He's trying to get respected and known, but he himself fuel his haters and make it worse by saying "i don't care lol" even when people just want to help him by pointing what makes him hated by a lot.. for some good reasons

You know me Sassy, i have often been on his stream, never offensive or whatever, i'm not an hardcore fan who'll follow him until death, i'm not an hater wanting to burn him right now, i could be considered a rival because i'm in the same "niche" of spreading mech in the community, but well, i'm really just the average guy enjoying the original play of one of the few remaining terran streamers, and i just want to give a realistic insight about this. Avilo could be a really great part of the community : he's someone who dares to try stuff, to speak freely, and who is ok with sharing his knowledge and advices. But for that, he has to shut down his "cocky non-caring-about-criticism bitchy" side, or he'll just be remembered like "that whiner who plays mech and is known because he rages more than Idra and made a couple of funny guides who acts like he's the man who made every single terran metagame evolution happen and sometimes say smart things... covered by a layer of rage"

Take it as you want obviously... Just wanting to help everyone, you, your fans, the community.. But at some point, when so many people tells you the same things again and again and again about your flaws, considering what you want to achieve, you should try to improve yourself instead of just ignoring them, blaming them, or acting like it's totally undeserved


When the majority of games on ladder you end up playing end up being vs Protoss every game abusing all-ins and nexus cannon...it's a bit unavoidable to discuss balance at that point.

On January 03 2014 09:23 darthfoley wrote:
Avilo is an odd character.

I was also apparently one of the people who should die because in my head, I pronouced it aveelo.


lmao :D never would i wish such a thing upon you for mispronouncing my username haha. Thanks for watching the stream

On January 03 2014 05:49 captainwaffles wrote:
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.


You are one of the most dedicated avilo haters of late. Get it straight. I do not accuse known pros of stream cheating/hacking ever. You and other little haters continue this BS with no context to the situation.

I have played known players before that were on barcodes metagaming the fuck out of me, and to any outside observer it would look like the guy was stream sniping in some way, and possibly stream cheating. Not my fault i didn't know some d00d sniping me was on a barcode.

If you honestly think i ever accuse known players of cheating, something is wrong with you. I never would.


This is what me and Lynna were talking about lol. Why would you even quote lynna if you're just going to ignore his constructive criticisms? Unlike me he still thinks theres hope for you I think this post of yours will show him that you are hopeless to become a positive in the scene


You really don't get it you do? I can't believe how dense you are. Your actions alone have warranted any negative actions people do onto you. Simple as that, look in the mirror if you want to find out why people would bm you.

You accuse everyone (Known players, random masters players, etc) of cheating all the time If you're gonna put your head in the sand and deny it and go la la la thats fine don't expect me to put any effort into pulling up examples with timestamps from your VODs.

Tbh I think Kane said it best:

"you have to understand he's not a mentally stable individual. it's completely obvious he has some sort of disability (i.e. autism, aspergers, etc.). You can't take anything he says seriously; no healthy individual would say half the stuff he says."

(source: http://www.reddit.com/r/starcraft/comments/1u4jly/why_is_avilo_so_mean_to_everyone_he_calls/ceefq3x)


Not going to respond to you anymore, except with: You need to go to jelly school, immediately.



Lynna addressed that as well,

"But for that, he has to shut down his "cocky non-caring-about-criticism bitchy" side, or he'll just be remembered like "that whiner who plays mech and is known because he rages more than Idra and made a couple of funny guides who acts like he's the man who made every single terran metagame evolution happen and sometimes say smart things... covered by a layer of rage"


Actually he said it pretty well I don't think I can say it any better.

So is this your version of conceding? You know I'm right so now you'll just pretend I don't exist and hope I go away? Your 12 year old self called he wants his maturity level back.
https://x.com/CaptainWaffless
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2014-01-03 04:33:16
January 03 2014 04:24 GMT
#380
For all the "flaws" you might think avilo has, I suggest you look in the mirror. He has never attacked anyone personally and for that matter isn't so rude to go into another persons stream thread and throw insults at them. You should be a shamed of yourselves.

@Lynna, yes, he has to pat himself on the back, because no one else gives him credit. I've seen him do things that other players got credit for. So, if his attitude is a bit exaggerated, it's understandable.

And like I said, if you don't like the guy, it's your option, but to come to HIS stream thread and BM him, is a pretty sad statement and makes you, waffles, less of a person than you perceive him to be.

P.S. @ Waffles...let me know when Kane gets his degree in psychiatry.


captainwaffles
Profile Blog Joined February 2009
United States1050 Posts
Last Edited: 2014-01-03 04:30:35
January 03 2014 04:30 GMT
#381
On January 03 2014 13:24 Arkansassy wrote:
For all the "flaws" you might think avilo has, I suggest you look in the mirror. He has never attacked anyone personally and for that matter isn't so rude to go into another persons stream thread and throw insults at them. You should be a shamed of yourselves.

@Lynna, yes, he has to pat himself on the back, because no one else gives him credit. I've seen him do things that other players got credit for. So, if his attitude is a bit exaggerated, it's understandable.

And like I said, if you don't like the guy, it's your option, but to come to HIS stream thread and BM him, is a pretty sad statement and makes you, waffles, less of a person than him.





Oh I'm sorry I thought you were going to stop replying to me? What gives? Truth train hits hard I suppose. The other guy brought this up too, this mentality that no one should be bm yet you support the king of bm himself... can you see the irony in this?


"I find it very strange that Avilo's fanbase emphasizes being nice and discourages BM as a whole while proclaiming that Avilo himself doesn't BM -- that he's the victim. That isn't the case though. I've played Avilo on the ladder, lost, and gotten BM'ed. I didn't snipe him, didn't stream cheat, I lost the game. Usually it was a stomp in the super late game and I still get BM'ed or whined at. It's the same when I watch his stream. He can hardly go a game without making a silly claim about balance or what have you whether it's provoked or not." -Shebuha

I will say this again because it seems you missed my point. His actions and his actions alone have warranted any BM he gets in return. You can't dish shit and not expect to take shit. You can try but you look about as pathetic as you do now, no reason no logic just "avilo good, everything else bad". Thats about how you sound right now.
https://x.com/CaptainWaffless
dvorakftw
Profile Blog Joined November 2011
681 Posts
January 03 2014 06:26 GMT
#382
On January 03 2014 11:14 Lyyna wrote:
he's trying to brag and give all credits to himself

This is the first I've heard of avilo not giving credit for builds because every other time it has been people (myself included) begging him to stop doing his own style and to start copying Korean pros.

One build he's done that he calls the 4-4-4 he said multiple times he based on something the Korean pro FanTaSy did. Aside from that who does he owe credit to? The typical names that get mentioned as also playing mech don't play it like he does.

On the other hand, everyone amazed last week by TY's use of a sensor tower to counter a blink all-in by herO in Proleague wouldn't have been amazed if they watched avilo because he's been doing it for months.

He wants to point flaws in balance and the overall game, but ends up talking about it every single hour of the day,

As avilo replied, it's hard to avoid the subject when more than every other game is against Protoss.

he himself fuel his haters and make it worse by saying "i don't care lol" even when people just want to help him by pointing what makes him hated by a lot.. for some good reasons

I've tried various suggestions, for example saying "gg" every time to make detractors happy but he prefers to only say it for games he actually feels were good by both players or in tournaments. It's easy to use the lack of gg against avilo and it would be an easy change for him to make, but in a way it's actually a sign of personal integrity.

But at some point, when so many people tells you the same things again and again and again about your flaws, considering what you want to achieve, you should try to improve yourself instead of just ignoring them, blaming them, or acting like it's totally undeserved

Y'know in high school lots of people told me again and again about my flaws and how I should change and act and the opinions I should have and how I should express them in order to be popular so I could sit at the cool kids table. I didn't change and I still had lunch with the cheerleaders every day.

It's funny. Tasteless (and others) get mocked for having lost the passion for SC2. avilo's problem clearly is too much passion. People complain about Blizzard not doing enough about hackers but avilo should never say a word about suspicious play. More and more evidence shows up that Protoss is too safe in the early game and Terran has too few viable builds but avilo should what, limit it to one five minute rant a day as he plays Protoss after Protoss on the ladder? And hate against avilo is okay because 'he started it' is a fine standard, even when he doesn't start it?
dvorakftw
Profile Blog Joined November 2011
681 Posts
January 03 2014 07:01 GMT
#383
On January 03 2014 13:30 captainwaffles wrote:
Oh I'm sorry I thought you were going to stop replying to me? What gives? Truth train hits hard I suppose.

Or...... it could be that Arkansassy and avilo are two different people. Score one for the home team. And you were feeling so smug and smart and good about yourself, weren't you?

The other guy brought this up too, this mentality that no one should be bm yet you support the king of bm himself... can you see the irony in this?

There is no irony here, Alanis. avilo laughs about the trash talk directed at him. He was treated as a punchline and his response was to stream more, practically every day. The flaw in your logic is that avilo's basic trash talk is returned a hundredfold, often on a personal level.
captainwaffles
Profile Blog Joined February 2009
United States1050 Posts
January 03 2014 07:32 GMT
#384
On January 03 2014 16:01 dvorakftw wrote:
Show nested quote +
On January 03 2014 13:30 captainwaffles wrote:
Oh I'm sorry I thought you were going to stop replying to me? What gives? Truth train hits hard I suppose.

Or...... it could be that Arkansassy and avilo are two different people. Score one for the home team. And you were feeling so smug and smart and good about yourself, weren't you?

Show nested quote +
The other guy brought this up too, this mentality that no one should be bm yet you support the king of bm himself... can you see the irony in this?

There is no irony here, Alanis. avilo laughs about the trash talk directed at him. He was treated as a punchline and his response was to stream more, practically every day. The flaw in your logic is that avilo's basic trash talk is returned a hundredfold, often on a personal level.



I got one person to stop responding to me because he knows I'm right and I got the other person to start replying to me again after she said she would stop, I did feel a bit smug about that.


Idk what you're even trying to say in the second part it has nothing to do with what I'm talking about. You quoted me and then said something that side stepped what I said.


I have no qualm with you. You're just a misguided fanboy. Enjoy the new year.
https://x.com/CaptainWaffless
Shebuha
Profile Blog Joined May 2011
Canada1335 Posts
Last Edited: 2014-01-03 08:46:28
January 03 2014 08:45 GMT
#385
On January 03 2014 12:16 avilo wrote:
Show nested quote +
On January 03 2014 09:34 captainwaffles wrote:
On January 03 2014 06:58 Shebuha wrote:
On January 03 2014 05:49 captainwaffles wrote:
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.

I find it very strange that Avilo's fanbase emphasizes being nice and discourages BM as a whole while proclaiming that Avilo himself doesn't BM -- that he's the victim. That isn't the case though. I've played Avilo on the ladder, lost, and gotten BM'ed. I didn't snipe him, didn't stream cheat, I lost the game. Usually it was a stomp in the super late game and I still get BM'ed or whined at. It's the same when I watch his stream. He can hardly go a game without making a silly claim about balance or what have you whether it's provoked or not.

He brings it on himself indeed.


Theres nothing strange about it, he just a hypocrite. Whats funny about it though is he'll say for example root players "bm him" and pretend to be angels everywhere else and here is doing the same exact thing, bming the fuck out of everyone and then when he gets called out he tries (keyword tries) to spin some kind of BS.


Oh you must have seen the game where i played a rootseed player and they thought it was perfectly acceptable to just insta unpause the game because it's "avilo." There are some people that think it's perfectly ok to BM me just because other people in the community do it, then they do it too because it's trendy or some shiot.

The difference is if I BM someone on ladder it's usually in fun and i'm just trolling...and i never personally insult them about who they are. I'll call someone bad every now and then, sure. Or gimmicky. I never insult their own person, nor would i want to.

First of all, I saw that game and what happened was you paused without saying anything. Not saying it's wrong or right to unpause immediately though. I personally just wait because I'm in no rush, but players that don't like you, whether it's because of popular opinion like you say, or because they have good reason won't.

Secondly, you called me retarded multiple times in one game when it was unprovoked -- admittedly it wasn't very recent -- but I hear from friends on the ladder that you continue to do shit similar to that, and it isn't fucking cool. Also, bm is bm... I don't understand how anyone can think some forms are okay and others are not. Additionally, if you bm/troll someone on the ladder who you don't know you really can't expect them to take it well every time when you don't know them. It doesn't help that some things are lost in translation due to text.
Lyyna
Profile Joined June 2011
France776 Posts
Last Edited: 2014-01-03 11:57:39
January 03 2014 11:43 GMT
#386
@dvorak : Anytime someone does something original he does, you are sure to find something on his twitter at the very least..

It's hard to avoid talking about balance, but there is a difference between talking about balance, and actually never leaving the subject, talking in very negative terms, and attributes all your losses to it

I don't give a frak about gg every game, the problem is the way he talks back to and about people general (even when people deserve it, what's the point of talking worse than them ? And what about random people he doesn't know at all ?), and the fact he can never accept any form of criticism. Look how he responded to my previous post... He himself makes sure that anything good he says (and he says a damn huge amount of right things) is going to get buried under rage and trashtalk

You weren't trying to be a known person in high school while complaining at the same time people are harsh to you and acting like they don't have any reason at all to do so, right ? That's what he's doing, and that's the problem. Asking for respect while keeping doing the exact things that create lack of respect.. ? That's idiotic

@Sassy : he never started personal attacks, but whenever someone dares to say a single bad word towards him, this person automatically become a streamsniper/cheater, a bad player, and deserves every single trashtalk. Honestly, how do you want not to be seen as a jerk when your 'defense" is to basically be a bigger jerk? Being attacked isn't a reason to act like that, especially when after that you talk about how unrespectful people are towards you and wonder why

There is quite a difference, again, between "having some original play before others" and "acting like every single innovation of your race is because of you". A Korean use nukes in lategame ? Brag on twitter, brag on stream, talks about how commentators takes credits away from you because hey praised the korean and not you even if you did the same thing 1.97 weeks and 3 days ago. Heavy raven use lategame ? Acts like you're the one who got copied by koreans. Banshees in mech TvP ? Omg Avilo discovered all of it in HotS and is the first mech terran even to do so !
He acts like he's THE one who does this before anyone else. Well, to take an example.. i use ravens and air switches in any MU since early 2011, and banshees were a big part of the TvP mech style that i made a guide of, back in early 2012. And well, i'm not fucking trying to get any credit for that, even if i can prove with bunchs of replays that i was doing most major innovations in the terran gameplay (switches, hellion/Banshee, mech with air support, w/e...) months or even a full year before any pro did it in a streamed game and made it my standards before avilo even started to try it seriously.
You give it in one word. "Exaggerated". He's going too far every time, when responding to someone who attacks him, when talking about his achievements, when talking about balance, etc.. he's himself creating the situation. Obiously it's good for him because as he said, haters makes him famous, but at some point, he has to chose between starting to deserve this respect he wants, or just dropping the part where he acts like his bad reputation is totally undeserved


I do like Avilo' style and insights and his whole good side, he can be a GREAT person with an insane knowledge and understanding of the game, and i say it again, he can be an absolutely huge and respected part of the community. But for that, he has to stop acting like he's doing right now, because he's just going full Idra at the moment. You want not to be seen as a jerk ? Then stop using any reason you can find to act like one, and stop acting like one.
Or if you really want to stay like this, at least try to assume it, stop asking for more respect/wondering why so much people hates you when you give yourself reasons for them to do so. Act like everyone is a mindless hater and stop acting any hate you get is totally undeserved. BUT.STOP.DOING.BOTH.AT.THE.SAME.TIME.

This is not fucking "hate". This is just me being realistic and trying to open everyone' eyes. Trying to ignore Avilo's flaws isn't helping him at all and only make his "whiner who plays mech and is known because he rages more than Idra and made a couple of funny guides who acts like he's the man who made every single terran metagame evolution happen and sometimes say smart things... covered by a layer of rage" position even worse because some people says he's right no matter what and will make him go further that way. Not everyone giving criticism is a hater, and hardcore fans aren't a good thing, it must be understood...
Dear god, people, including avilo himself, try to turn this into a war with only 2 sides : people who are actively supporting him by not doing anything negative (even when deserved), and absolutely all the others, people who want to burn him right away. A fucking war between terran and protoss, a fucking war between people who only aim at discrediting the other hardert, a fucking war between every single mech terran to get popular, a fucking war with koreans to be crowned as innovative, a fucking retarded war with everyone involved with avilo's playstyle, stream, or reputation. Don't you realize there might be an in-between with people who JUST wants the whole situation to get better by being REALISTIC and trying to make both sides OPEN THEIR EYES?


finished editing everything, i'll just let it like there. Probably will stop responding too, since trying to put everyone in a better position seems a lost cause. I'm really sad because of this, this is absolutely idiotic to ends up in a situation like this just because people...oh well, i don't even know
Good luck for the rest
http://www.teamliquid.net/forum/sc2-strategy/459600-how-to-mech-them-cry-lyynas-mech-in-hots - The 2014 Mech guide ! http://www.twitch.tv/lyyna for stream and contact infos
RaZorwire
Profile Joined April 2012
Sweden718 Posts
January 03 2014 13:00 GMT
#387
I agree with Lyyna. Not everyone who criticizes is a hater. I throughly enjoy Avilo's stream due to his playstyle and genuine enthusiasm, but I still find his condescending attitude annoying. A lot of the hate that's been directed against him over the past few years has been injustified, but that doesn't mean that everyone who comments on his manners is just out to ruin his day just because they can. I like Avilo's style, and I would like it even more if he could tone the rage down and start giving credit to his opponents where credit is due.
dvorakftw
Profile Blog Joined November 2011
681 Posts
Last Edited: 2014-01-03 17:52:45
January 03 2014 17:52 GMT
#388
On January 03 2014 20:43 Lyyna wrote:
I don't give a frak about gg every game

But some do. Different people have different standards. I personally don't care for trash talk and it seems you really don't like it but some people do and overall I prefer honest emotional responses to someone always biting their tongue. While I would love to see avilo become a statesman for StarCraft, I can't say it is an ideal role for him.

It's a fine line and I don't expect everyone to make the distinction but I can't recall a single case of avilo's trash talk being a direct attack against anyone. There is an important difference when "This guy is retarded" means 'He has a mental problem' and when it means 'He's doing something in the game that is a bad idea'.

Arkansassy
Profile Joined October 2010
358 Posts
January 03 2014 20:34 GMT
#389
lol Dvorak, you should become a spokesperson for avilo. Your posts are well-written and right on.

I said it once and I'll say it again...people that have a problem with avilo should simply stay away. You're certainly not welcome in his fan club. Start your own "hate" thread, please.

I have confidence that the TL mods will soon realize that you are not only stalking avilo, but harassing him as well. And you're doing it for the same reason a lot of viewers have, because they were banned from chat for being terribly BM, not regarding his game play, but with personal attacks.
d00p
Profile Blog Joined May 2011
711 Posts
January 03 2014 21:01 GMT
#390
I dunno, I don't want to join his fanclub or anything but recently I find my self tuning in to catch a game here and there and I always enjoy it. He doesn't seem that bm but I don't really have good sample size to comment. I don't understand the game that well these days and probably can't tell who is good and who is bad (perhaps never could?). But still, is it just me or is Avilo one of the stronger NA players out there? He seems to regularly stomp pretty big names and he seems really passionate. That makes him likeable to me.

Btw there is no guestion toss isn't op right now. But then again hasn't he been complaining about it forever since way back in woL? Toss doesn't fit his style that's for sure.
dvorakftw
Profile Blog Joined November 2011
681 Posts
January 03 2014 21:25 GMT
#391
On January 04 2014 06:01 d00p wrote:
But still, is it just me or is Avilo one of the stronger NA players out there? He seems to regularly stomp pretty big names

He is regularly in the top 50 GM and could easily be top 10 if he didn't have so many TvPs.

[H]asn't he been complaining about [TvP] forever since way back in woL?

The main problem in TvP for mech players is that the Immortal is too good against the Siege Tank and that still hasn't changed. Changes such as the tank buff where siege no longer needs to be researched isn't a real help because the Mothership Core makes blink all-ins can hit before you can have more than one tank and has the Photon Overcharge spell that outranges siege.
avilo
Profile Blog Joined November 2007
United States4100 Posts
January 03 2014 23:44 GMT
#392
On January 04 2014 06:01 d00p wrote:
I dunno, I don't want to join his fanclub or anything but recently I find my self tuning in to catch a game here and there and I always enjoy it. He doesn't seem that bm but I don't really have good sample size to comment. I don't understand the game that well these days and probably can't tell who is good and who is bad (perhaps never could?). But still, is it just me or is Avilo one of the stronger NA players out there? He seems to regularly stomp pretty big names and he seems really passionate. That makes him likeable to me.

Btw there is no guestion toss isn't op right now. But then again hasn't he been complaining about it forever since way back in woL? Toss doesn't fit his style that's for sure.


Hey, i appreciate your comments, and thanks for watching And yes, I do often times beat very good players, and have one of the more consistent mech styles imo. A lot of people underrate me, as well as try to discredit me on a lot of things just because...they don't like my personality lol. Jealousy is quite the bioch it seems.

As for the BM, you're pretty spot on, i'm not that BM. I rage every now and then about the same as any player does. Perhaps more so about TvP in the past months, but i don't think that's too unexpected lol.

I used to rage and whine about TvP a LOT in Wings of Liberty, my TvP was utter trash level. Then I started to learn the game more, defend all-ins, and learned/innovated the ghost/viking + nuke late game style. I stopped complaining, and just got very good at TvP and was even comfortable with the match-up.

Then came HOTS, and suddenly i feel I am losing to players 10x worse than myself, even though i am still practicing hard. My winrate became abysmal, despite all of the hard work and improvements i'd put in...it felt exactly like the brood/infestor era of Wings...and i'd say i was pretty accurate when i called out TvP had issues months ago.

That's really the only time i rage or "whine" nowadays - after TvP games. I will do my best not to when blizzard balances that match-up a bit more...as for TvT and TvZ, i usually criticize and analyze my own mistakes after games i lose, often times berating myself at how idiotic i just played or what dumb mistakes i made if i happened to have succumbed to any.

Just yesterday I played a game and lost to a ling/bane all-in i knew was coming because i didn't evacuate the SCVS at my natural into my main for what would have been a freewin.

There are always trolls in my chat that say i'm making excuses when i do this analysis after the game, but thinking about it...I think people say this because i don't go back into the replay while analyzing why i lost. A lot of people need a visual to go along with the analysis.

I personally can just recap the game inside my head and recognize why i lost instantly...which is why i don't manually open the replay, but perhaps there's a disconnect to some of my stream viewers where they think i'm just simply making excuses when i actually just replayed the entire game and what happened in my brain lol.

I'll try and open the replays more often
Sup
captainwaffles
Profile Blog Joined February 2009
United States1050 Posts
Last Edited: 2014-01-03 23:58:12
January 03 2014 23:57 GMT
#393
On January 04 2014 08:44 avilo wrote:
Show nested quote +
On January 04 2014 06:01 d00p wrote:
I dunno, I don't want to join his fanclub or anything but recently I find my self tuning in to catch a game here and there and I always enjoy it. He doesn't seem that bm but I don't really have good sample size to comment. I don't understand the game that well these days and probably can't tell who is good and who is bad (perhaps never could?). But still, is it just me or is Avilo one of the stronger NA players out there? He seems to regularly stomp pretty big names and he seems really passionate. That makes him likeable to me.

Btw there is no guestion toss isn't op right now. But then again hasn't he been complaining about it forever since way back in woL? Toss doesn't fit his style that's for sure.


Hey, i appreciate your comments, and thanks for watching And yes, I do often times beat very good players, and have one of the more consistent mech styles imo. A lot of people underrate me, as well as try to discredit me on a lot of things just because...they don't like my personality lol. Jealousy is quite the bioch it seems.

As for the BM, you're pretty spot on, i'm not that BM. I rage every now and then about the same as any player does. Perhaps more so about TvP in the past months, but i don't think that's too unexpected lol.

I used to rage and whine about TvP a LOT in Wings of Liberty, my TvP was utter trash level. Then I started to learn the game more, defend all-ins, and learned/innovated the ghost/viking + nuke late game style. I stopped complaining, and just got very good at TvP and was even comfortable with the match-up.

Then came HOTS, and suddenly i feel I am losing to players 10x worse than myself, even though i am still practicing hard. My winrate became abysmal, despite all of the hard work and improvements i'd put in...it felt exactly like the brood/infestor era of Wings...and i'd say i was pretty accurate when i called out TvP had issues months ago.

That's really the only time i rage or "whine" nowadays - after TvP games. I will do my best not to when blizzard balances that match-up a bit more...as for TvT and TvZ, i usually criticize and analyze my own mistakes after games i lose, often times berating myself at how idiotic i just played or what dumb mistakes i made if i happened to have succumbed to any.

Just yesterday I played a game and lost to a ling/bane all-in i knew was coming because i didn't evacuate the SCVS at my natural into my main for what would have been a freewin.

There are always trolls in my chat that say i'm making excuses when i do this analysis after the game, but thinking about it...I think people say this because i don't go back into the replay while analyzing why i lost. A lot of people need a visual to go along with the analysis.

I personally can just recap the game inside my head and recognize why i lost instantly...which is why i don't manually open the replay, but perhaps there's a disconnect to some of my stream viewers where they think i'm just simply making excuses when i actually just replayed the entire game and what happened in my brain lol.

I'll try and open the replays more often


Meant to PM, not post, disregard.
https://x.com/CaptainWaffless
aeligos
Profile Joined January 2013
United States172 Posts
January 04 2014 01:30 GMT
#394
Please add me to Avilo's fan club. Thank you.
libera te tvtemet ex inferis A.'.A.'.
Giant Robot
Profile Joined August 2012
38 Posts
January 05 2014 07:34 GMT
#395
Will Avilo compete in any of the WCS Qualifiers?
Will Green bananas ruin banana bread?
neoghaleon55
Profile Blog Joined August 2010
United States7435 Posts
January 05 2014 07:48 GMT
#396
every time there is a new patchnote or balance change, I find myself looking up avilo's opinion first...
...I guess that makes me a fan.
Sign me up.
lol
moo...for DRG
SC2Toastie
Profile Blog Joined October 2013
Netherlands5725 Posts
January 05 2014 08:30 GMT
#397
On January 03 2014 20:43 Lyyna wrote:
@dvorak : Anytime someone does something original he does, you are sure to find something on his twitter at the very least..

It's hard to avoid talking about balance, but there is a difference between talking about balance, and actually never leaving the subject, talking in very negative terms, and attributes all your losses to it

I don't give a frak about gg every game, the problem is the way he talks back to and about people general (even when people deserve it, what's the point of talking worse than them ? And what about random people he doesn't know at all ?), and the fact he can never accept any form of criticism. Look how he responded to my previous post... He himself makes sure that anything good he says (and he says a damn huge amount of right things) is going to get buried under rage and trashtalk

You weren't trying to be a known person in high school while complaining at the same time people are harsh to you and acting like they don't have any reason at all to do so, right ? That's what he's doing, and that's the problem. Asking for respect while keeping doing the exact things that create lack of respect.. ? That's idiotic

@Sassy : he never started personal attacks, but whenever someone dares to say a single bad word towards him, this person automatically become a streamsniper/cheater, a bad player, and deserves every single trashtalk. Honestly, how do you want not to be seen as a jerk when your 'defense" is to basically be a bigger jerk? Being attacked isn't a reason to act like that, especially when after that you talk about how unrespectful people are towards you and wonder why

There is quite a difference, again, between "having some original play before others" and "acting like every single innovation of your race is because of you". A Korean use nukes in lategame ? Brag on twitter, brag on stream, talks about how commentators takes credits away from you because hey praised the korean and not you even if you did the same thing 1.97 weeks and 3 days ago. Heavy raven use lategame ? Acts like you're the one who got copied by koreans. Banshees in mech TvP ? Omg Avilo discovered all of it in HotS and is the first mech terran even to do so !
He acts like he's THE one who does this before anyone else. Well, to take an example.. i use ravens and air switches in any MU since early 2011, and banshees were a big part of the TvP mech style that i made a guide of, back in early 2012. And well, i'm not fucking trying to get any credit for that, even if i can prove with bunchs of replays that i was doing most major innovations in the terran gameplay (switches, hellion/Banshee, mech with air support, w/e...) months or even a full year before any pro did it in a streamed game and made it my standards before avilo even started to try it seriously.
You give it in one word. "Exaggerated". He's going too far every time, when responding to someone who attacks him, when talking about his achievements, when talking about balance, etc.. he's himself creating the situation. Obiously it's good for him because as he said, haters makes him famous, but at some point, he has to chose between starting to deserve this respect he wants, or just dropping the part where he acts like his bad reputation is totally undeserved


I do like Avilo' style and insights and his whole good side, he can be a GREAT person with an insane knowledge and understanding of the game, and i say it again, he can be an absolutely huge and respected part of the community. But for that, he has to stop acting like he's doing right now, because he's just going full Idra at the moment. You want not to be seen as a jerk ? Then stop using any reason you can find to act like one, and stop acting like one.
Or if you really want to stay like this, at least try to assume it, stop asking for more respect/wondering why so much people hates you when you give yourself reasons for them to do so. Act like everyone is a mindless hater and stop acting any hate you get is totally undeserved. BUT.STOP.DOING.BOTH.AT.THE.SAME.TIME.

This is not fucking "hate". This is just me being realistic and trying to open everyone' eyes. Trying to ignore Avilo's flaws isn't helping him at all and only make his "whiner who plays mech and is known because he rages more than Idra and made a couple of funny guides who acts like he's the man who made every single terran metagame evolution happen and sometimes say smart things... covered by a layer of rage" position even worse because some people says he's right no matter what and will make him go further that way. Not everyone giving criticism is a hater, and hardcore fans aren't a good thing, it must be understood...
Dear god, people, including avilo himself, try to turn this into a war with only 2 sides : people who are actively supporting him by not doing anything negative (even when deserved), and absolutely all the others, people who want to burn him right away. A fucking war between terran and protoss, a fucking war between people who only aim at discrediting the other hardert, a fucking war between every single mech terran to get popular, a fucking war with koreans to be crowned as innovative, a fucking retarded war with everyone involved with avilo's playstyle, stream, or reputation. Don't you realize there might be an in-between with people who JUST wants the whole situation to get better by being REALISTIC and trying to make both sides OPEN THEIR EYES?


finished editing everything, i'll just let it like there. Probably will stop responding too, since trying to put everyone in a better position seems a lost cause. I'm really sad because of this, this is absolutely idiotic to ends up in a situation like this just because people...oh well, i don't even know
Good luck for the rest

I've been here, just stop it. Nothing to gain, waste of time.
Mura Ma Man, Dark Da Dude, Super Shot Sos!
bri9and
Profile Blog Joined June 2010
United States246 Posts
January 06 2014 20:39 GMT
#398
Avillo is by far the most entertaining stream for me.. His mech style is fun to watch and very different than the current metagame. I find his knowledge of the game to be top notch and while he has some BM from time to time, i don't think it is over the top or unwarranted. Also, I absolutely love the Kung Fu moves after the match.. Huk tried this but couldn't match the intensity of comic factor.. but I did appreciate the effort. I am most definitely an avillo fan and love watching his stream.. stream more, man!
I don't have time to play with myself
NorthQuab
Profile Joined January 2014
United States23 Posts
January 07 2014 02:47 GMT
#399
Honestly, I feel like a part of a terran brotherhood in the avilo stream chat. It just feels so right hanging out with the brovilos while being enlightened on How to best mech it Happen.

Also, I wanted to thank avilo for going over my replay, because I was always really nervous about my 2fac 3cc blueflame opener because I came up with it myself and I wasnt sure if it was just outright bad or not :D
#pulltheboys
9-BiT
Profile Blog Joined January 2012
United States1089 Posts
January 07 2014 07:26 GMT
#400
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.

Wow you must have a lot of experience playing the victim because you're very good at it. Avilo always instigates discussions, and then plays the victim. He'll be a great fit on eg.
kwark_uk: @father_sc learn to play maybe?
Arkansassy
Profile Joined October 2010
358 Posts
January 07 2014 18:46 GMT
#401
thank you, 9-bit, for your comment; however, i don't see how that particular post made me out to be a victim. Perhaps you misinterpreted what I said? Perhaps I didn't state my case clearly? I'm in no way a victim, nor do I feel like one.

@Bri9and and NorthQuab, your comments made me smile and I'm sure they'll bring a smile to avilo's face as well. Thank you.
Kevin_Sorbo
Profile Joined November 2011
Canada3217 Posts
January 07 2014 21:21 GMT
#402
we dont watch his stream for the drama afaik.

just leave it at that...
The mind is like a parachute, it doesnt work unless its open. - Zappa
PaeZ
Profile Joined April 2005
Mexico1627 Posts
January 08 2014 02:00 GMT
#403
Please add me
NorthQuab
Profile Joined January 2014
United States23 Posts
January 09 2014 00:20 GMT
#404
How could I forget something so important! Sign me up please! :D
#pulltheboys
00higgo
Profile Joined May 2013
Australia119 Posts
Last Edited: 2014-01-09 05:24:02
January 09 2014 05:19 GMT
#405
Avilo did the other day enter a TvP, lift his CC instantly and start calling some random guy a B**ch and a mother F**ker then continued to say "play find the cc". I mean all things considered he has a long history of provoking BM and whining and his chat is quite toxic as well. if this is what people like then more power to them. He often personally attacks player's under the guise of "Balance talk"
Arkansassy
Profile Joined October 2010
358 Posts
January 09 2014 18:49 GMT
#406
Thank you for stating your opinion, 00higgo. I agree that avilo can be bad mannered at times, but only after getting frustrated with 14 TvPs in a row lol He's not the only Terran that complains about the match-up and most of the time, what you deem as inappropriate are comments made in jest.

As far as chat being toxic, what makes it toxic is haters coming into chat with their bad manners. At times mods can barely keep up. We run a pretty tight ship in chat, but have been told by many others that most streams don't give warnings, they just ban. We, on the other hand, like to give the haters the benefit of the doubt and give them warnings before a time out.

Last night a person who was making insane comments and was breaking the house rules (not to mention annoying other viewers, who kept telling me to just ban him) was given over seven warnings, because he really wasn't being bad mannered, but was sorely wrong in what he was saying. After the last warning, he was banned. I then received a heart-warming PM that stated "F...You, B...." hahaha Ofc, according to him, I was in the wrong for banning him.

We not only discourage bad manners in avilo's chat, but insist that his regular viewers do not display bad manners in other streamer's chat.

I've seen you on avilo's stream a lot and you've, for the most part, been a very mannered viewer; however, my suggestion to you would be if you have a problem with avilo or his chat, don't watch. It would be much nicer than spreading hate in his FanClub thread.

Thank you, again, for taking the time to post your opinion.
PanN
Profile Blog Joined December 2008
United States2828 Posts
Last Edited: 2014-01-09 23:30:48
January 09 2014 23:11 GMT
#407
On January 10 2014 03:49 Arkansassy wrote:
Thank you for stating your opinion, 00higgo. I agree that avilo can be bad mannered at times, but only after getting frustrated with 14 TvPs in a row lol He's not the only Terran that complains about the match-up and most of the time, what you deem as inappropriate are comments made in jest.

As far as chat being toxic, what makes it toxic is haters coming into chat with their bad manners. At times mods can barely keep up. We run a pretty tight ship in chat, but have been told by many others that most streams don't give warnings, they just ban. We, on the other hand, like to give the haters the benefit of the doubt and give them warnings before a time out.

Last night a person who was making insane comments and was breaking the house rules (not to mention annoying other viewers, who kept telling me to just ban him) was given over seven warnings, because he really wasn't being bad mannered, but was sorely wrong in what he was saying. After the last warning, he was banned. I then received a heart-warming PM that stated "F...You, B...." hahaha Ofc, according to him, I was in the wrong for banning him.

We not only discourage bad manners in avilo's chat, but insist that his regular viewers do not display bad manners in other streamer's chat.

I've seen you on avilo's stream a lot and you've, for the most part, been a very mannered viewer; however, my suggestion to you would be if you have a problem with avilo or his chat, don't watch. It would be much nicer than spreading hate in his FanClub thread.

Thank you, again, for taking the time to post your opinion.


So avilo according to this other guy starts the game with name calling somebody, then being a man-child floats his CC away, and thats totally ok in your eyes because he played 14 tvps, and if you don't like it you can not watch.

So, theres this little thing in life that everyone experiences, its called criticism. When you avoid criticism and make excuses constantly you don't learn, you don't improve, you don't grow as a human being. Stop sticking your fingers in you and avilos ears and singing "LALAALALLALALALALA" the moment someone says something negative about the stream. Believe it or not, not all criticism is to just fuck with your head or make you feel shitty, some of it is actually constructive. Hence constructive criticism (something many people in this thread have given avilo, but apparently they're always the bad guy)

"Don't like it don't watch it" what a disgustingly simple way to view things. Maybe people like watching avilos stream but don't like the way he acts sometimes? Have you or avilo ever thought about that before? Maybe they want to see avilo not be such a jerk to others and would rather see him succeed with a good attitude?

He has MANY, and I mean many valid complaints, I agree with him on a lot of things and I don't even play T or P. But I'd much rather see him complain and try to get things changed in a constructive way instead of calling somebody a bitch motherfucker and floating his cc, like what the hell is that? Is that honestly too much to ask? Maybe it is. Avilo ignores all (probably most, not all) criticism and you just tell everybody if they don't like it leave.

I also honestly can't believe that you can openly discuss how nice and mannered a viewer has been, but in the same breath tell him that he shouldn't watch if hes going to "spread hate". ...... are you for real? He's not spreading hate, he's calling out another human being for being mean, thats not "spreading hate". You yourself said hes been mannered in the chat, then he comes in here and just simply mentions that avilo was being a jerk one day, and you label it as "spreading hate". Thats the definition of a joke right there.

You are beyond delusional if you actually believe that every single person out there just hates on avilo for no reason. I'm on the side that avilo gets way too much shit, more than he deserves for sure, but to act like even a portion of it isn't justified shows how blind you can be. It's not even just love at this point, its a willful desire to just ignore a very obvious issue with how avilo treats opponents. I don't care how many tvp's he played in one day, I don't care if every single P was BM vs him for literally no reason, I don't care if they messaged him after the game to rub it in or whatever. It doesn't give him the right to treat an opponent like garbage, to treat another human being like trash. If he did, he should apologize, thats what adults do, or at least try to make an effort to not be that way again. He doesn't need people like you giving excuses for every action he commits, he doesn't need a justifiable reason to be implemented into every bad decision he makes. He needs to own up to his mistakes, and how can he do that when people such as yourself just immediately defend him and brush the issue off likes its nothing?

Fact is avilos a cool dude, good player, amusing personality, but a douche to a good percentage of his opponents. Why's the last part so necessary? All of his comments are just in jest? I don't believe that nonsense sorry. No matter how much both of you say it. There's a difference between being humorously bad mannered, and just a douchebag. and if he was lifting his cc cussing somebody out, then, for at least that very moment, he fell under the latter category.

Is that a big deal? No, everybody has those moments where they acted like a dick, everybody. But what do you do to fix it? Make excuses? Have your GF endlessly defend you? etc etc? No. You either apologize and move on, or move on and try not to do it again. But calling it all in jest.... excuses. Excuses are a cheap way of making your self feel better without actually owning up to the issue at hand and admitting responsibility. Excuses are weak, and so are avilos manners for other human beings.
We have multiple brackets generated in advance. Relax . (Kennigit) I just simply do not understand how it can be the time to play can be 22nd at 9:30 pm PST / midnight the 23rd at the same time. (GGzerg)
SC2Toastie
Profile Blog Joined October 2013
Netherlands5725 Posts
January 10 2014 00:05 GMT
#408
^ This is gonna be interesting. Very well worded!
Mura Ma Man, Dark Da Dude, Super Shot Sos!
avilo
Profile Blog Joined November 2007
United States4100 Posts
January 10 2014 00:34 GMT
#409
On January 10 2014 08:11 PanN wrote:
Show nested quote +
On January 10 2014 03:49 Arkansassy wrote:
Thank you for stating your opinion, 00higgo. I agree that avilo can be bad mannered at times, but only after getting frustrated with 14 TvPs in a row lol He's not the only Terran that complains about the match-up and most of the time, what you deem as inappropriate are comments made in jest.

As far as chat being toxic, what makes it toxic is haters coming into chat with their bad manners. At times mods can barely keep up. We run a pretty tight ship in chat, but have been told by many others that most streams don't give warnings, they just ban. We, on the other hand, like to give the haters the benefit of the doubt and give them warnings before a time out.

Last night a person who was making insane comments and was breaking the house rules (not to mention annoying other viewers, who kept telling me to just ban him) was given over seven warnings, because he really wasn't being bad mannered, but was sorely wrong in what he was saying. After the last warning, he was banned. I then received a heart-warming PM that stated "F...You, B...." hahaha Ofc, according to him, I was in the wrong for banning him.

We not only discourage bad manners in avilo's chat, but insist that his regular viewers do not display bad manners in other streamer's chat.

I've seen you on avilo's stream a lot and you've, for the most part, been a very mannered viewer; however, my suggestion to you would be if you have a problem with avilo or his chat, don't watch. It would be much nicer than spreading hate in his FanClub thread.

Thank you, again, for taking the time to post your opinion.


So avilo according to this other guy starts the game with name calling somebody, then being a man-child floats his CC away, and thats totally ok in your eyes because he played 14 tvps, and if you don't like it you can not watch.

So, theres this little thing in life that everyone experiences, its called criticism. When you avoid criticism and make excuses constantly you don't learn, you don't improve, you don't grow as a human being. Stop sticking your fingers in you and avilos ears and singing "LALAALALLALALALALA" the moment someone says something negative about the stream. Believe it or not, not all criticism is to just fuck with your head or make you feel shitty, some of it is actually constructive. Hence constructive criticism (something many people in this thread have given avilo, but apparently they're always the bad guy)

"Don't like it don't watch it" what a disgustingly simple way to view things. Maybe people like watching avilos stream but don't like the way he acts sometimes? Have you or avilo ever thought about that before? Maybe they want to see avilo not be such a jerk to others and would rather see him succeed with a good attitude?

He has MANY, and I mean many valid complaints, I agree with him on a lot of things and I don't even play T or P. But I'd much rather see him complain and try to get things changed in a constructive way instead of calling somebody a bitch motherfucker and floating his cc, like what the hell is that? Is that honestly too much to ask? Maybe it is. Avilo ignores all (probably most, not all) criticism and you just tell everybody if they don't like it leave.

I also honestly can't believe that you can openly discuss how nice and mannered a viewer has been, but in the same breath tell him that he shouldn't watch if hes going to "spread hate". ...... are you for real? He's not spreading hate, he's calling out another human being for being mean, thats not "spreading hate". You yourself said hes been mannered in the chat, then he comes in here and just simply mentions that avilo was being a jerk one day, and you label it as "spreading hate". Thats the definition of a joke right there.

You are beyond delusional if you actually believe that every single person out there just hates on avilo for no reason. I'm on the side that avilo gets way too much shit, more than he deserves for sure, but to act like even a portion of it isn't justified shows how blind you can be. It's not even just love at this point, its a willful desire to just ignore a very obvious issue with how avilo treats opponents. I don't care how many tvp's he played in one day, I don't care if every single P was BM vs him for literally no reason, I don't care if they messaged him after the game to rub it in or whatever. It doesn't give him the right to treat an opponent like garbage, to treat another human being like trash. If he did, he should apologize, thats what adults do, or at least try to make an effort to not be that way again. He doesn't need people like you giving excuses for every action he commits, he doesn't need a justifiable reason to be implemented into every bad decision he makes. He needs to own up to his mistakes, and how can he do that when people such as yourself just immediately defend him and brush the issue off likes its nothing?

Fact is avilos a cool dude, good player, amusing personality, but a douche to a good percentage of his opponents. Why's the last part so necessary? All of his comments are just in jest? I don't believe that nonsense sorry. No matter how much both of you say it. There's a difference between being humorously bad mannered, and just a douchebag. and if he was lifting his cc cussing somebody out, then, for at least that very moment, he fell under the latter category.

Is that a big deal? No, everybody has those moments where they acted like a dick, everybody. But what do you do to fix it? Make excuses? Have your GF endlessly defend you? etc etc? No. You either apologize and move on, or move on and try not to do it again. But calling it all in jest.... excuses. Excuses are a cheap way of making your self feel better without actually owning up to the issue at hand and admitting responsibility. Excuses are weak, and so are avilos manners for other human beings.


This is a fanclub thread, if you want to go make a TL thread about me and how much you dislike me or how i've somehow destroyed puppies, you're free to go do that and have it closed within 30 seconds i'm sure.

Otherwise don't bother posting here, thx.
Sup
SC2Toastie
Profile Blog Joined October 2013
Netherlands5725 Posts
January 10 2014 00:47 GMT
#410
Quoted:
Avilo ignores all (probably most, not all) criticism and you just tell everybody if they don't like it leave.

Avilo's response made me laugh. Didn't you take the time to read what he wrote.

Fact is, Avilo plays an interesting style, but there's a good number of people refraining from viewing the stream because of all the endless insulting and whining going on. I am one of those people, I only watch Avilo muted, because it really bothers me to see him being so disrespectful.
Why, Avilo, why not be a nice person and have a ton more viewers and offer people a learnfull experience instead of degenerating EVERY SINGLE LOSS into "LOL PROTOSS WHAT A FAG". You mostly lose because of your own mistakes, but you are too blind (or act like it at least) to see that and take advise to heart.

I'm really curious on what you think about it yourself. Walking away from your problems is not the way to g.
Mura Ma Man, Dark Da Dude, Super Shot Sos!
Shebuha
Profile Blog Joined May 2011
Canada1335 Posts
January 10 2014 00:59 GMT
#411
On January 10 2014 09:34 avilo wrote:
Show nested quote +
On January 10 2014 08:11 PanN wrote:
On January 10 2014 03:49 Arkansassy wrote:
Thank you for stating your opinion, 00higgo. I agree that avilo can be bad mannered at times, but only after getting frustrated with 14 TvPs in a row lol He's not the only Terran that complains about the match-up and most of the time, what you deem as inappropriate are comments made in jest.

As far as chat being toxic, what makes it toxic is haters coming into chat with their bad manners. At times mods can barely keep up. We run a pretty tight ship in chat, but have been told by many others that most streams don't give warnings, they just ban. We, on the other hand, like to give the haters the benefit of the doubt and give them warnings before a time out.

Last night a person who was making insane comments and was breaking the house rules (not to mention annoying other viewers, who kept telling me to just ban him) was given over seven warnings, because he really wasn't being bad mannered, but was sorely wrong in what he was saying. After the last warning, he was banned. I then received a heart-warming PM that stated "F...You, B...." hahaha Ofc, according to him, I was in the wrong for banning him.

We not only discourage bad manners in avilo's chat, but insist that his regular viewers do not display bad manners in other streamer's chat.

I've seen you on avilo's stream a lot and you've, for the most part, been a very mannered viewer; however, my suggestion to you would be if you have a problem with avilo or his chat, don't watch. It would be much nicer than spreading hate in his FanClub thread.

Thank you, again, for taking the time to post your opinion.


So avilo according to this other guy starts the game with name calling somebody, then being a man-child floats his CC away, and thats totally ok in your eyes because he played 14 tvps, and if you don't like it you can not watch.

So, theres this little thing in life that everyone experiences, its called criticism. When you avoid criticism and make excuses constantly you don't learn, you don't improve, you don't grow as a human being. Stop sticking your fingers in you and avilos ears and singing "LALAALALLALALALALA" the moment someone says something negative about the stream. Believe it or not, not all criticism is to just fuck with your head or make you feel shitty, some of it is actually constructive. Hence constructive criticism (something many people in this thread have given avilo, but apparently they're always the bad guy)

"Don't like it don't watch it" what a disgustingly simple way to view things. Maybe people like watching avilos stream but don't like the way he acts sometimes? Have you or avilo ever thought about that before? Maybe they want to see avilo not be such a jerk to others and would rather see him succeed with a good attitude?

He has MANY, and I mean many valid complaints, I agree with him on a lot of things and I don't even play T or P. But I'd much rather see him complain and try to get things changed in a constructive way instead of calling somebody a bitch motherfucker and floating his cc, like what the hell is that? Is that honestly too much to ask? Maybe it is. Avilo ignores all (probably most, not all) criticism and you just tell everybody if they don't like it leave.

I also honestly can't believe that you can openly discuss how nice and mannered a viewer has been, but in the same breath tell him that he shouldn't watch if hes going to "spread hate". ...... are you for real? He's not spreading hate, he's calling out another human being for being mean, thats not "spreading hate". You yourself said hes been mannered in the chat, then he comes in here and just simply mentions that avilo was being a jerk one day, and you label it as "spreading hate". Thats the definition of a joke right there.

You are beyond delusional if you actually believe that every single person out there just hates on avilo for no reason. I'm on the side that avilo gets way too much shit, more than he deserves for sure, but to act like even a portion of it isn't justified shows how blind you can be. It's not even just love at this point, its a willful desire to just ignore a very obvious issue with how avilo treats opponents. I don't care how many tvp's he played in one day, I don't care if every single P was BM vs him for literally no reason, I don't care if they messaged him after the game to rub it in or whatever. It doesn't give him the right to treat an opponent like garbage, to treat another human being like trash. If he did, he should apologize, thats what adults do, or at least try to make an effort to not be that way again. He doesn't need people like you giving excuses for every action he commits, he doesn't need a justifiable reason to be implemented into every bad decision he makes. He needs to own up to his mistakes, and how can he do that when people such as yourself just immediately defend him and brush the issue off likes its nothing?

Fact is avilos a cool dude, good player, amusing personality, but a douche to a good percentage of his opponents. Why's the last part so necessary? All of his comments are just in jest? I don't believe that nonsense sorry. No matter how much both of you say it. There's a difference between being humorously bad mannered, and just a douchebag. and if he was lifting his cc cussing somebody out, then, for at least that very moment, he fell under the latter category.

Is that a big deal? No, everybody has those moments where they acted like a dick, everybody. But what do you do to fix it? Make excuses? Have your GF endlessly defend you? etc etc? No. You either apologize and move on, or move on and try not to do it again. But calling it all in jest.... excuses. Excuses are a cheap way of making your self feel better without actually owning up to the issue at hand and admitting responsibility. Excuses are weak, and so are avilos manners for other human beings.


This is a fanclub thread, if you want to go make a TL thread about me and how much you dislike me or how i've somehow destroyed puppies, you're free to go do that and have it closed within 30 seconds i'm sure.

Otherwise don't bother posting here, thx.

He just wants you to and that other guy who loves you to acknowledge your flaws and try to fix them rather than deny them, he even complemented you in his post. Just a page or two ago you both said that you never ever attack people personally, EVER, then I posted that you did it to me, then a guy posted that you did it the other day, and you continue to ignore it.
dvorakftw
Profile Blog Joined November 2011
681 Posts
Last Edited: 2014-01-10 01:31:23
January 10 2014 01:29 GMT
#412
Actually nevermind.
00higgo
Profile Joined May 2013
Australia119 Posts
Last Edited: 2014-01-10 02:35:27
January 10 2014 02:28 GMT
#413
On January 10 2014 03:49 Arkansassy wrote:
Thank you for stating your opinion, 00higgo. I agree that avilo can be bad mannered at times, but only after getting frustrated with 14 TvPs in a row lol He's not the only Terran that complains about the match-up and most of the time, what you deem as inappropriate are comments made in jest.

As far as chat being toxic, what makes it toxic is haters coming into chat with their bad manners. At times mods can barely keep up. We run a pretty tight ship in chat, but have been told by many others that most streams don't give warnings, they just ban. We, on the other hand, like to give the haters the benefit of the doubt and give them warnings before a time out.

Last night a person who was making insane comments and was breaking the house rules (not to mention annoying other viewers, who kept telling me to just ban him) was given over seven warnings, because he really wasn't being bad mannered, but was sorely wrong in what he was saying. After the last warning, he was banned. I then received a heart-warming PM that stated "F...You, B...." hahaha Ofc, according to him, I was in the wrong for banning him.

We not only discourage bad manners in avilo's chat, but insist that his regular viewers do not display bad manners in other streamer's chat.

I've seen you on avilo's stream a lot and you've, for the most part, been a very mannered viewer; however, my suggestion to you would be if you have a problem with avilo or his chat, don't watch. It would be much nicer than spreading hate in his FanClub thread.

Thank you, again, for taking the time to post your opinion.


Thanks for the advice and i have stopped viewing his stream for the reasons i stated, however the toxic part of chat is in my opinion is not the haters as he has a small proportion of them compared to other streamers but the emphasis on balance whining from mods and fans as well as Avilo.
I have visited the stream on many occasions and i always see the same thing, its cringe worthy and the only reason i decided to post here was the multiple instants of you and Avilo saying he does not personally attack players.
I will no longer post here or visit his stream but as has been stated, you can't be as disrespectful to the community as him and not expect people to call you on it from time to time.
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2014-01-17 06:43:21
January 11 2014 21:47 GMT
#414
deleted for reasons that you will never understand.
9-BiT
Profile Blog Joined January 2012
United States1089 Posts
January 12 2014 00:18 GMT
#415
On January 10 2014 09:34 avilo wrote:
Show nested quote +
On January 10 2014 08:11 PanN wrote:
On January 10 2014 03:49 Arkansassy wrote:
Thank you for stating your opinion, 00higgo. I agree that avilo can be bad mannered at times, but only after getting frustrated with 14 TvPs in a row lol He's not the only Terran that complains about the match-up and most of the time, what you deem as inappropriate are comments made in jest.

As far as chat being toxic, what makes it toxic is haters coming into chat with their bad manners. At times mods can barely keep up. We run a pretty tight ship in chat, but have been told by many others that most streams don't give warnings, they just ban. We, on the other hand, like to give the haters the benefit of the doubt and give them warnings before a time out.

Last night a person who was making insane comments and was breaking the house rules (not to mention annoying other viewers, who kept telling me to just ban him) was given over seven warnings, because he really wasn't being bad mannered, but was sorely wrong in what he was saying. After the last warning, he was banned. I then received a heart-warming PM that stated "F...You, B...." hahaha Ofc, according to him, I was in the wrong for banning him.

We not only discourage bad manners in avilo's chat, but insist that his regular viewers do not display bad manners in other streamer's chat.

I've seen you on avilo's stream a lot and you've, for the most part, been a very mannered viewer; however, my suggestion to you would be if you have a problem with avilo or his chat, don't watch. It would be much nicer than spreading hate in his FanClub thread.

Thank you, again, for taking the time to post your opinion.


So avilo according to this other guy starts the game with name calling somebody, then being a man-child floats his CC away, and thats totally ok in your eyes because he played 14 tvps, and if you don't like it you can not watch.

So, theres this little thing in life that everyone experiences, its called criticism. When you avoid criticism and make excuses constantly you don't learn, you don't improve, you don't grow as a human being. Stop sticking your fingers in you and avilos ears and singing "LALAALALLALALALALA" the moment someone says something negative about the stream. Believe it or not, not all criticism is to just fuck with your head or make you feel shitty, some of it is actually constructive. Hence constructive criticism (something many people in this thread have given avilo, but apparently they're always the bad guy)

"Don't like it don't watch it" what a disgustingly simple way to view things. Maybe people like watching avilos stream but don't like the way he acts sometimes? Have you or avilo ever thought about that before? Maybe they want to see avilo not be such a jerk to others and would rather see him succeed with a good attitude?

He has MANY, and I mean many valid complaints, I agree with him on a lot of things and I don't even play T or P. But I'd much rather see him complain and try to get things changed in a constructive way instead of calling somebody a bitch motherfucker and floating his cc, like what the hell is that? Is that honestly too much to ask? Maybe it is. Avilo ignores all (probably most, not all) criticism and you just tell everybody if they don't like it leave.

I also honestly can't believe that you can openly discuss how nice and mannered a viewer has been, but in the same breath tell him that he shouldn't watch if hes going to "spread hate". ...... are you for real? He's not spreading hate, he's calling out another human being for being mean, thats not "spreading hate". You yourself said hes been mannered in the chat, then he comes in here and just simply mentions that avilo was being a jerk one day, and you label it as "spreading hate". Thats the definition of a joke right there.

You are beyond delusional if you actually believe that every single person out there just hates on avilo for no reason. I'm on the side that avilo gets way too much shit, more than he deserves for sure, but to act like even a portion of it isn't justified shows how blind you can be. It's not even just love at this point, its a willful desire to just ignore a very obvious issue with how avilo treats opponents. I don't care how many tvp's he played in one day, I don't care if every single P was BM vs him for literally no reason, I don't care if they messaged him after the game to rub it in or whatever. It doesn't give him the right to treat an opponent like garbage, to treat another human being like trash. If he did, he should apologize, thats what adults do, or at least try to make an effort to not be that way again. He doesn't need people like you giving excuses for every action he commits, he doesn't need a justifiable reason to be implemented into every bad decision he makes. He needs to own up to his mistakes, and how can he do that when people such as yourself just immediately defend him and brush the issue off likes its nothing?

Fact is avilos a cool dude, good player, amusing personality, but a douche to a good percentage of his opponents. Why's the last part so necessary? All of his comments are just in jest? I don't believe that nonsense sorry. No matter how much both of you say it. There's a difference between being humorously bad mannered, and just a douchebag. and if he was lifting his cc cussing somebody out, then, for at least that very moment, he fell under the latter category.

Is that a big deal? No, everybody has those moments where they acted like a dick, everybody. But what do you do to fix it? Make excuses? Have your GF endlessly defend you? etc etc? No. You either apologize and move on, or move on and try not to do it again. But calling it all in jest.... excuses. Excuses are a cheap way of making your self feel better without actually owning up to the issue at hand and admitting responsibility. Excuses are weak, and so are avilos manners for other human beings.


This is a fanclub thread, if you want to go make a TL thread about me and how much you dislike me or how i've somehow destroyed puppies, you're free to go do that and have it closed within 30 seconds i'm sure.

Otherwise don't bother posting here, thx.

That was pretty much what I expected.
kwark_uk: @father_sc learn to play maybe?
bosnia
Profile Joined October 2002
Canada223 Posts
January 12 2014 01:50 GMT
#416
LOL!
TL member since 2002, Protoss ftw!!
NorthQuab
Profile Joined January 2014
United States23 Posts
January 12 2014 03:06 GMT
#417
I'm sorry you feel that way, sassy. You always have been a nice person, even in the face of people like those you described. I wish you the best of luck in the future and maybe you can come on back to us when you feel you can <3
#pulltheboys
RaZorwire
Profile Joined April 2012
Sweden718 Posts
January 12 2014 20:28 GMT
#418
Sorry for your loss, Sassy.
NorthQuab
Profile Joined January 2014
United States23 Posts
January 13 2014 16:13 GMT
#419
Watching avilo play in tournaments was super fun, even if it didnt go too well. Watching the mech master play in legit tournaments was a great change of pace from just watching him ladder. Also khaldor is one of my fave casters so i was in sc2 heaven aside from the loss best of luck in the future!
#pulltheboys
Sherlock117
Profile Joined April 2013
United States40 Posts
January 13 2014 16:40 GMT
#420
On January 14 2014 01:13 NorthQuab wrote:
Watching avilo play in tournaments was super fun, even if it didnt go too well. Watching the mech master play in legit tournaments was a great change of pace from just watching him ladder. Also khaldor is one of my fave casters so i was in sc2 heaven aside from the loss best of luck in the future!


I agree. It's good to see avilo playing in "real matches". Too bad he missed the IEM qualifier and hasn't looked for an opportunity to try his hand at some of the AM Lan events there have been in the past few months. It seems like there are more and more of those popping up so hopefully we'll see him at a few.

Good luck in the Ladder qualifier today Avilo. Hope you can be playing well and focused (even against Protoss) and make a nice run.
NorthQuab
Profile Joined January 2014
United States23 Posts
January 13 2014 20:13 GMT
#421
My prayers answered! Avilo vs solo on basetradetv! GOGO avilo!
#pulltheboys
plogamer
Profile Blog Joined January 2012
Canada3132 Posts
January 13 2014 21:55 GMT
#422
Well played vs JIG in game 2. That was intense.
Liman
Profile Joined July 2012
Serbia681 Posts
Last Edited: 2014-01-13 21:57:05
January 13 2014 21:56 GMT
#423
Vote for Avilo on MLG !
http://gameon.gg/vote
That game was epic !
Freelancer veteran
Sherlock117
Profile Joined April 2013
United States40 Posts
Last Edited: 2014-01-14 01:04:13
January 13 2014 22:21 GMT
#424
Too bad you had to play the last game against Jig on Daedalus Point. Rifkin gave you big props casting your game though for good manners and just playing the game anyways and throughout all of game 2. Hopefully that can turn some of the hate away!

Wish you could have qualified since you had a very reasonable draw with no protosses, but it was a really good showing. Hopefully you can get even better and qualify in season 2.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
January 18 2014 18:49 GMT
#425
On January 03 2014 12:56 avilo wrote:
Show nested quote +
On January 03 2014 12:45 captainwaffles wrote:
On January 03 2014 12:16 avilo wrote:
On January 03 2014 09:34 captainwaffles wrote:
On January 03 2014 06:58 Shebuha wrote:
On January 03 2014 05:49 captainwaffles wrote:
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.

I find it very strange that Avilo's fanbase emphasizes being nice and discourages BM as a whole while proclaiming that Avilo himself doesn't BM -- that he's the victim. That isn't the case though. I've played Avilo on the ladder, lost, and gotten BM'ed. I didn't snipe him, didn't stream cheat, I lost the game. Usually it was a stomp in the super late game and I still get BM'ed or whined at. It's the same when I watch his stream. He can hardly go a game without making a silly claim about balance or what have you whether it's provoked or not.

He brings it on himself indeed.


Theres nothing strange about it, he just a hypocrite. Whats funny about it though is he'll say for example root players "bm him" and pretend to be angels everywhere else and here is doing the same exact thing, bming the fuck out of everyone and then when he gets called out he tries (keyword tries) to spin some kind of BS.


Oh you must have seen the game where i played a rootseed player and they thought it was perfectly acceptable to just insta unpause the game because it's "avilo." There are some people that think it's perfectly ok to BM me just because other people in the community do it, then they do it too because it's trendy or some shiot.

The difference is if I BM someone on ladder it's usually in fun and i'm just trolling...and i never personally insult them about who they are. I'll call someone bad every now and then, sure. Or gimmicky. I never insult their own person, nor would i want to.

On January 03 2014 11:14 Lyyna wrote:
The problem with Avilo is that his goals are right, but the ways he's trying to achieve them are awful...
he wants to help terrans to get better with guides and tips and analysis and innovative play, but he's trying to brag and give all credits to himself (may be ironical or not... but what matters is how it is perceived by most people, and this is affected by his overall behavior) whenever someone else does something similar, be it fellow foreigners streamers, or koreans pro in streamed tournaments
He wants to point flaws in balance and the overall game, but ends up talking about it every single hour of the day, tries to prove his ideas with whatever (sometimes unrelated) things he can get his hands on and attributes a lot of his losses to this
He's denouncing the terrible attitude some people have about him, but ends up being as much as a jerk than these people, and making it even worse by often raging and yelling at some random people for whatever reasons
He's trying to get respected and known, but he himself fuel his haters and make it worse by saying "i don't care lol" even when people just want to help him by pointing what makes him hated by a lot.. for some good reasons

You know me Sassy, i have often been on his stream, never offensive or whatever, i'm not an hardcore fan who'll follow him until death, i'm not an hater wanting to burn him right now, i could be considered a rival because i'm in the same "niche" of spreading mech in the community, but well, i'm really just the average guy enjoying the original play of one of the few remaining terran streamers, and i just want to give a realistic insight about this. Avilo could be a really great part of the community : he's someone who dares to try stuff, to speak freely, and who is ok with sharing his knowledge and advices. But for that, he has to shut down his "cocky non-caring-about-criticism bitchy" side, or he'll just be remembered like "that whiner who plays mech and is known because he rages more than Idra and made a couple of funny guides who acts like he's the man who made every single terran metagame evolution happen and sometimes say smart things... covered by a layer of rage"

Take it as you want obviously... Just wanting to help everyone, you, your fans, the community.. But at some point, when so many people tells you the same things again and again and again about your flaws, considering what you want to achieve, you should try to improve yourself instead of just ignoring them, blaming them, or acting like it's totally undeserved


When the majority of games on ladder you end up playing end up being vs Protoss every game abusing all-ins and nexus cannon...it's a bit unavoidable to discuss balance at that point.

On January 03 2014 09:23 darthfoley wrote:
Avilo is an odd character.

I was also apparently one of the people who should die because in my head, I pronouced it aveelo.


lmao :D never would i wish such a thing upon you for mispronouncing my username haha. Thanks for watching the stream

On January 03 2014 05:49 captainwaffles wrote:
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.


You are one of the most dedicated avilo haters of late. Get it straight. I do not accuse known pros of stream cheating/hacking ever. You and other little haters continue this BS with no context to the situation.

I have played known players before that were on barcodes metagaming the fuck out of me, and to any outside observer it would look like the guy was stream sniping in some way, and possibly stream cheating. Not my fault i didn't know some d00d sniping me was on a barcode.

If you honestly think i ever accuse known players of cheating, something is wrong with you. I never would.


This is what me and Lynna were talking about lol. Why would you even quote lynna if you're just going to ignore his constructive criticisms? Unlike me he still thinks theres hope for you I think this post of yours will show him that you are hopeless to become a positive in the scene


You really don't get it you do? I can't believe how dense you are. Your actions alone have warranted any negative actions people do onto you. Simple as that, look in the mirror if you want to find out why people would bm you.

You accuse everyone (Known players, random masters players, etc) of cheating all the time If you're gonna put your head in the sand and deny it and go la la la thats fine don't expect me to put any effort into pulling up examples with timestamps from your VODs.

Tbh I think Kane said it best:

"you have to understand he's not a mentally stable individual. it's completely obvious he has some sort of disability (i.e. autism, aspergers, etc.). You can't take anything he says seriously; no healthy individual would say half the stuff he says."

(source: http://www.reddit.com/r/starcraft/comments/1u4jly/why_is_avilo_so_mean_to_everyone_he_calls/ceefq3x)


Not going to respond to you anymore, except with: You need to go to jelly school, immediately.

Haha good one Avilo. "Jelly school". That quote is going in Phrase of the Day for sure. It's also just begging for a cartoonist to draw a picture of a school full of strawberry jelly or something.
Procrastination is the enemy
avilo
Profile Blog Joined November 2007
United States4100 Posts
January 18 2014 21:07 GMT
#426
On January 19 2014 03:49 codonbyte wrote:
Show nested quote +
On January 03 2014 12:56 avilo wrote:
On January 03 2014 12:45 captainwaffles wrote:
On January 03 2014 12:16 avilo wrote:
On January 03 2014 09:34 captainwaffles wrote:
On January 03 2014 06:58 Shebuha wrote:
On January 03 2014 05:49 captainwaffles wrote:
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.

I find it very strange that Avilo's fanbase emphasizes being nice and discourages BM as a whole while proclaiming that Avilo himself doesn't BM -- that he's the victim. That isn't the case though. I've played Avilo on the ladder, lost, and gotten BM'ed. I didn't snipe him, didn't stream cheat, I lost the game. Usually it was a stomp in the super late game and I still get BM'ed or whined at. It's the same when I watch his stream. He can hardly go a game without making a silly claim about balance or what have you whether it's provoked or not.

He brings it on himself indeed.


Theres nothing strange about it, he just a hypocrite. Whats funny about it though is he'll say for example root players "bm him" and pretend to be angels everywhere else and here is doing the same exact thing, bming the fuck out of everyone and then when he gets called out he tries (keyword tries) to spin some kind of BS.


Oh you must have seen the game where i played a rootseed player and they thought it was perfectly acceptable to just insta unpause the game because it's "avilo." There are some people that think it's perfectly ok to BM me just because other people in the community do it, then they do it too because it's trendy or some shiot.

The difference is if I BM someone on ladder it's usually in fun and i'm just trolling...and i never personally insult them about who they are. I'll call someone bad every now and then, sure. Or gimmicky. I never insult their own person, nor would i want to.

On January 03 2014 11:14 Lyyna wrote:
The problem with Avilo is that his goals are right, but the ways he's trying to achieve them are awful...
he wants to help terrans to get better with guides and tips and analysis and innovative play, but he's trying to brag and give all credits to himself (may be ironical or not... but what matters is how it is perceived by most people, and this is affected by his overall behavior) whenever someone else does something similar, be it fellow foreigners streamers, or koreans pro in streamed tournaments
He wants to point flaws in balance and the overall game, but ends up talking about it every single hour of the day, tries to prove his ideas with whatever (sometimes unrelated) things he can get his hands on and attributes a lot of his losses to this
He's denouncing the terrible attitude some people have about him, but ends up being as much as a jerk than these people, and making it even worse by often raging and yelling at some random people for whatever reasons
He's trying to get respected and known, but he himself fuel his haters and make it worse by saying "i don't care lol" even when people just want to help him by pointing what makes him hated by a lot.. for some good reasons

You know me Sassy, i have often been on his stream, never offensive or whatever, i'm not an hardcore fan who'll follow him until death, i'm not an hater wanting to burn him right now, i could be considered a rival because i'm in the same "niche" of spreading mech in the community, but well, i'm really just the average guy enjoying the original play of one of the few remaining terran streamers, and i just want to give a realistic insight about this. Avilo could be a really great part of the community : he's someone who dares to try stuff, to speak freely, and who is ok with sharing his knowledge and advices. But for that, he has to shut down his "cocky non-caring-about-criticism bitchy" side, or he'll just be remembered like "that whiner who plays mech and is known because he rages more than Idra and made a couple of funny guides who acts like he's the man who made every single terran metagame evolution happen and sometimes say smart things... covered by a layer of rage"

Take it as you want obviously... Just wanting to help everyone, you, your fans, the community.. But at some point, when so many people tells you the same things again and again and again about your flaws, considering what you want to achieve, you should try to improve yourself instead of just ignoring them, blaming them, or acting like it's totally undeserved


When the majority of games on ladder you end up playing end up being vs Protoss every game abusing all-ins and nexus cannon...it's a bit unavoidable to discuss balance at that point.

On January 03 2014 09:23 darthfoley wrote:
Avilo is an odd character.

I was also apparently one of the people who should die because in my head, I pronouced it aveelo.


lmao :D never would i wish such a thing upon you for mispronouncing my username haha. Thanks for watching the stream

On January 03 2014 05:49 captainwaffles wrote:
On January 03 2014 01:46 Arkansassy wrote:
Other than the fact that the members of Root (with the exception of perhaps two of their members) have obviously sniped avilo (too much of a coincidence imo to be matched up with a Root member more than 4-5 times in a row) they are just plain hateful toward avilo for no good reason other than the fact they don't like him. Of course, if I don't like someone, I just avoid him/her - maybe that's too mature.

If I had been with avilo the night he did the showmatch v minigun, I would have vehemently discouraged his decision.Too many times, he has played Root members who were reported to be in Skype with the opponent and on avilo's stream at the same time. I'm not saying that this was the case that night, but my decision would have been based on the fact that avilo was off his game earlier and was extremely tired when I left him.

At one time I had had hopes for the SC Community, because there are a lot of nice people involved, but it seems the haters always win out and that's a sad statement to make.

Avilo's chat was one of the nicest, most fun places to be and viewers enjoyed it, because the mods protected viewers against BM. The haters have tried to ruin it for us and even though people keep telling me that "the more viewers, the more trolls" I don't understand why that has to be. Surely, parents have brought they're kids up better and would be mortified if they knew how extremely rude and repulsive they're kids are online.

I'm hoping that this New Year will bring more compassion and caring for others - both online and off. Cheating on ladder proves nothing. Hateful trolling, in part, is some misguided kid, who is angry and disappointed with his/her own life and has to vent for their own well being, albeit in a very destructive way. They need to feel a part of something and it's much easier to jump on the haters bandwagon than to stand up and fight for those upon whom the hate is thrust.

Wishing you all a better New Year.



Yeah it wouldn't have anything to do with his constant BM, balance whine, inability to take shit which he himself dishes out everyday, accusing well known pros of stream cheating/map hacking after every loss. This isn't anything that hasn't been mentioned before so I'll keep this short with a simple sentence: Any "hate" avilo gets he brought on himself if you honestly think its undeserved then Idk what to tell you.


You are one of the most dedicated avilo haters of late. Get it straight. I do not accuse known pros of stream cheating/hacking ever. You and other little haters continue this BS with no context to the situation.

I have played known players before that were on barcodes metagaming the fuck out of me, and to any outside observer it would look like the guy was stream sniping in some way, and possibly stream cheating. Not my fault i didn't know some d00d sniping me was on a barcode.

If you honestly think i ever accuse known players of cheating, something is wrong with you. I never would.


This is what me and Lynna were talking about lol. Why would you even quote lynna if you're just going to ignore his constructive criticisms? Unlike me he still thinks theres hope for you I think this post of yours will show him that you are hopeless to become a positive in the scene


You really don't get it you do? I can't believe how dense you are. Your actions alone have warranted any negative actions people do onto you. Simple as that, look in the mirror if you want to find out why people would bm you.

You accuse everyone (Known players, random masters players, etc) of cheating all the time If you're gonna put your head in the sand and deny it and go la la la thats fine don't expect me to put any effort into pulling up examples with timestamps from your VODs.

Tbh I think Kane said it best:

"you have to understand he's not a mentally stable individual. it's completely obvious he has some sort of disability (i.e. autism, aspergers, etc.). You can't take anything he says seriously; no healthy individual would say half the stuff he says."

(source: http://www.reddit.com/r/starcraft/comments/1u4jly/why_is_avilo_so_mean_to_everyone_he_calls/ceefq3x)


Not going to respond to you anymore, except with: You need to go to jelly school, immediately.

Haha good one Avilo. "Jelly school". That quote is going in Phrase of the Day for sure. It's also just begging for a cartoonist to draw a picture of a school full of strawberry jelly or something.


It's from South Park tho lol look it up :D
Sup
codonbyte
Profile Blog Joined June 2011
United States840 Posts
January 19 2014 00:08 GMT
#427
BREAKING NEWS *** BREAKING NEWS *** BREAKING NEWS *** BREAKING NEWS *** BREAKING NEWS

AVILO BEATS MINIGUN IN ZOTAC NA CUP USING MECH! THATS RIGHT FOLKS!! AVILO BEAT PROTOSS WITH MECH!!!!! AND THE PROTOSS WAS MINIGUN!! WHO'S ACTUALLY GOOD!!!! AND MINIGUN WENT CARRIERS!! HE WENT STRAIGHT TO CARRIERS!!!! YET SOMEHOW, AVILO MANAGED TO SPANK HIS BROKEN ASS!!!
Procrastination is the enemy
Nightsz
Profile Blog Joined February 2011
Canada398 Posts
January 19 2014 00:16 GMT
#428
On January 19 2014 09:08 codonbyte wrote:
BREAKING NEWS *** BREAKING NEWS *** BREAKING NEWS *** BREAKING NEWS *** BREAKING NEWS

AVILO BEATS MINIGUN IN ZOTAC NA CUP USING MECH! THATS RIGHT FOLKS!! AVILO BEAT PROTOSS WITH MECH!!!!! AND THE PROTOSS WAS MINIGUN!! WHO'S ACTUALLY GOOD!!!! AND MINIGUN WENT CARRIERS!! HE WENT STRAIGHT TO CARRIERS!!!! YET SOMEHOW, AVILO MANAGED TO SPANK HIS BROKEN ASS!!!


Minigun threw away the game by storming his own units, all i can say lmao
neoghaleon55
Profile Blog Joined August 2010
United States7435 Posts
January 24 2014 04:09 GMT
#429
what the hell?!
Where is my avilo opinion on balance test map 1/24
I've been waiting all day to read it
moo...for DRG
NorthQuab
Profile Joined January 2014
United States23 Posts
January 24 2014 04:21 GMT
#430
On January 24 2014 13:09 neoghaleon55 wrote:
what the hell?!
Where is my avilo opinion on balance test map 1/24
I've been waiting all day to read it



I think he is uploading/has uploaded a metagame update, so hold fast! :D
#pulltheboys
codonbyte
Profile Blog Joined June 2011
United States840 Posts
January 29 2014 02:23 GMT
#431
Fanclub has been updated, guys, with PROOF that Avilo is NOT the only one to say that protoss is underpowered, although he does seem to get 100% of the hate for it.

[image loading]
Procrastination is the enemy
Shebuha
Profile Blog Joined May 2011
Canada1335 Posts
February 08 2014 08:13 GMT
#432
^ Taeja is a notorious balance whiner...
Thalandros
Profile Blog Joined July 2012
Netherlands1151 Posts
February 08 2014 12:34 GMT
#433
Plus I dont think anyone ever disagreed with the fact that you can be slow and a good protoss player, also that the race is less mechanically intensive (not that Avilo would know much about that but that's a discussion for later )
|| ''I think we have all experienced passion that is not in any sense reasonable.'' ||
lamprey1
Profile Joined June 2012
Canada919 Posts
February 08 2014 14:49 GMT
#434
u have been railing against Blizzard's balance team for a long while now.
if u have little faith in their ability to make a solid balanced game...
isn't it time to .. as Lebron James stated...
take your talents to... some other game?

there are lots of competitive games that you can earn a decent living playing.

why not consider switching to a different game Avilo ?
Sherlock117
Profile Joined April 2013
United States40 Posts
February 13 2014 05:50 GMT
#435
You going to qualify tonight Avilo? Good luck! Hope you've done everything you could do to prepare.
wmb
Profile Joined February 2014
Sweden282 Posts
February 16 2014 16:09 GMT
#436
avilo i challenge u bo5 ;3 with prize for winner do you accept?
Hi I'm the infamous wmb, Diamond 1 / Challenger Player.
Ziggles
Profile Joined January 2013
United States3 Posts
February 17 2014 01:31 GMT
#437
welcome to mech #ENDERSGAMEONBLURAY
Practice practice practice, and if you're not practicing, keep practicing - Fatal1ty FAVORITE TEAM IS SLAYERS NO ICON THO:(
Jornada
Profile Joined February 2012
United States223 Posts
February 19 2014 21:15 GMT
#438
LOL!! This kid Avilo is raging hard!! whining non-stop on his stream right now!! kicking his chair and throwing cups!! OMG LOL!
www.twitch.tv/jornada28 Master Protoss. Follow me on Twitter for SC2 Updates https://twitter.com/#!/elelvlent
Kevin_Sorbo
Profile Joined November 2011
Canada3217 Posts
February 19 2014 21:36 GMT
#439
On February 20 2014 06:15 Jornada wrote:
LOL!! This kid Avilo is raging hard!! whining non-stop on his stream right now!! kicking his chair and throwing cups!! OMG LOL!

1st time tuning in?
The mind is like a parachute, it doesnt work unless its open. - Zappa
JkaySC
Profile Joined January 2013
Germany5 Posts
March 12 2014 19:32 GMT
#440
<3 avilo
“Darkness cannot drive out darkness: only light can do that. Hate cannot drive out hate: only love can do that.” ― Martin Luther King Jr
Pierrot
Profile Joined November 2012
Canada53 Posts
March 25 2014 15:46 GMT
#441
gj i guess
starslayer
Profile Joined August 2011
United States696 Posts
Last Edited: 2014-04-20 19:09:03
April 20 2014 05:51 GMT
#442
LOL @ avilo played a fun game and it ended with this and thought you might find this pretty funny made my day http://imgur.com/xkWnUhP
i came here to kickass and chew bubblegum and i'm all out of bubble gum
lamprey1
Profile Joined June 2012
Canada919 Posts
May 27 2014 12:13 GMT
#443
your stream is entertaining.
your trashing of Blizzard and its game designers is out of line and off-base.

you're a fun and entertaining RTS player to watch.
you are not 1/100th the game designer Dustin Browder is.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2014-07-09 14:46:03
July 08 2014 03:07 GMT
#444
Helloooo Brovilos (and Avibros, I guess), I've updated the fanclub with a collection of screenshots that show other streamers are becoming jealous of Avilo! This is really exciting, Brovilos! When other prominent members in a community become insecure enough to try and censor your name, then you KNOW you've become successful!

Oh yeah, and sorry for the delay in updates. I need to become more consistent. I have this problem in real life, too. And let me tell you, it really sucks
Procrastination is the enemy
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 08 2014 03:24 GMT
#445
On April 20 2014 14:51 starslayer wrote:
LOL @ avilo played a fun game and it ended with this and thought you might find this pretty funny made my day http://imgur.com/xkWnUhP

Thank you Starslayer, I'll be adding this to the fanclub right now!
Procrastination is the enemy
Arkansassy
Profile Joined October 2010
358 Posts
July 09 2014 02:55 GMT
#446
Codon, I had to stay away from the community for a while due to the death of a close friend; however, I'm so happy you linked me this. The updates are hilariously funny, but sad too that people have to hate so hard.

Thank you so much for the update and your hard work. You've been a faithful friend and are greatly appreciated.

Thank you, too, to his many fans and viewers, who remain forever loyal and who aren't afraid to stand up for avilo. They know the real him.

Have fun on his stream...that's what he wants and enjoys.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 09 2014 02:59 GMT
#447
On July 09 2014 11:55 Arkansassy wrote:
Codon, I had to stay away from the community for a while due to the death of a close friend; however, I'm so happy you linked me this. The updates are hilariously funny, but sad too that people have to hate so hard.

Thank you so much for the update and your hard work. You've been a faithful friend and are greatly appreciated.

Thank you, too, to his many fans and viewers, who remain forever loyal and who aren't afraid to stand up for avilo. They know the real him.

Have fun on his stream...that's what he wants and enjoys.

Well sazzy, talking to you about all the hate in the community is what inspired these posts in his fanclub. I'm done trying to convert the haters.

When life gives you lemons, you make lemonade, and when life gives you hate, you make haterade!!! So yes. From now on, I am going to post hate that is obviously jealousy-induced into his fanclub, because if people are jealous of you, then you KNOW you're a successful mofo :D
Procrastination is the enemy
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2014-07-09 03:25:58
July 09 2014 03:18 GMT
#448
**edit pending**
Procrastination is the enemy
PanN
Profile Blog Joined December 2008
United States2828 Posts
Last Edited: 2014-07-09 03:34:02
July 09 2014 03:33 GMT
#449
On July 09 2014 11:59 codonbyte wrote:
Show nested quote +
On July 09 2014 11:55 Arkansassy wrote:
Codon, I had to stay away from the community for a while due to the death of a close friend; however, I'm so happy you linked me this. The updates are hilariously funny, but sad too that people have to hate so hard.

Thank you so much for the update and your hard work. You've been a faithful friend and are greatly appreciated.

Thank you, too, to his many fans and viewers, who remain forever loyal and who aren't afraid to stand up for avilo. They know the real him.

Have fun on his stream...that's what he wants and enjoys.

Well sazzy, talking to you about all the hate in the community is what inspired these posts in his fanclub. I'm done trying to convert the haters.

When life gives you lemons, you make lemonade, and when life gives you hate, you make haterade!!! So yes. From now on, I am going to post hate that is obviously jealousy-induced into his fanclub, because if people are jealous of you, then you KNOW you're a successful mofo :D


Not everybody that makes fun of avilo is jealous of him. You think TB's jealous? I mean, I appreciate your approach, but its just not reality to assume that everyone is jealous just because they have malice towards him. I'd even say its on the lesser end of the people that hate on him.
We have multiple brackets generated in advance. Relax . (Kennigit) I just simply do not understand how it can be the time to play can be 22nd at 9:30 pm PST / midnight the 23rd at the same time. (GGzerg)
LingBlingBling
Profile Joined December 2012
United States353 Posts
Last Edited: 2014-07-09 11:06:03
July 09 2014 11:04 GMT
#450
On July 09 2014 12:33 PanN wrote:
Show nested quote +
On July 09 2014 11:59 codonbyte wrote:
On July 09 2014 11:55 Arkansassy wrote:
Codon, I had to stay away from the community for a while due to the death of a close friend; however, I'm so happy you linked me this. The updates are hilariously funny, but sad too that people have to hate so hard.

Thank you so much for the update and your hard work. You've been a faithful friend and are greatly appreciated.

Thank you, too, to his many fans and viewers, who remain forever loyal and who aren't afraid to stand up for avilo. They know the real him.

Have fun on his stream...that's what he wants and enjoys.

Well sazzy, talking to you about all the hate in the community is what inspired these posts in his fanclub. I'm done trying to convert the haters.

When life gives you lemons, you make lemonade, and when life gives you hate, you make haterade!!! So yes. From now on, I am going to post hate that is obviously jealousy-induced into his fanclub, because if people are jealous of you, then you KNOW you're a successful mofo :D


Not everybody that makes fun of avilo is jealous of him. You think TB's jealous? I mean, I appreciate your approach, but its just not reality to assume that everyone is jealous just because they have malice towards him. I'd even say its on the lesser end of the people that hate on him.



still kinda sad and unprofessional for progressed casters and popular Esport personalities to take shots at Avilo live on air because they don't have better material, pretty pathetic. I mean they gone far enough to hate on his personal life, where Avilo has it rough with hard times that his family is going through and money issues.

Avilo just talks about balance and entertains people on his stream, I have no clue why GSL casters and the terrible mods in proleague/wcs chats have to perm ban him as well, while bad mouthing him on Air.

Seems like these people have taken it to far, like cyber harassment on avilo these days, messed up to me.
Remember our motto: We ain't got it.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 09 2014 14:45 GMT
#451
On July 09 2014 12:33 PanN wrote:
Show nested quote +
On July 09 2014 11:59 codonbyte wrote:
On July 09 2014 11:55 Arkansassy wrote:
Codon, I had to stay away from the community for a while due to the death of a close friend; however, I'm so happy you linked me this. The updates are hilariously funny, but sad too that people have to hate so hard.

Thank you so much for the update and your hard work. You've been a faithful friend and are greatly appreciated.

Thank you, too, to his many fans and viewers, who remain forever loyal and who aren't afraid to stand up for avilo. They know the real him.

Have fun on his stream...that's what he wants and enjoys.

Well sazzy, talking to you about all the hate in the community is what inspired these posts in his fanclub. I'm done trying to convert the haters.

When life gives you lemons, you make lemonade, and when life gives you hate, you make haterade!!! So yes. From now on, I am going to post hate that is obviously jealousy-induced into his fanclub, because if people are jealous of you, then you KNOW you're a successful mofo :D


Not everybody that makes fun of avilo is jealous of him. You think TB's jealous? I mean, I appreciate your approach, but its just not reality to assume that everyone is jealous just because they have malice towards him. I'd even say its on the lesser end of the people that hate on him.

The comment about Haterade was mostly referring to streamers that ban anyone who says his name in their chats. And in the case of one of the streamers that does that (Winter), I actually do have evidence that he is jealous of Avilo. You saw the posts he made on BNet gloating about how the changes David Kim is considering don't benefit Avilo whatsoever.

And as far as TotalBiscuit is concerned, I just find the whole situation more funny than anything else. I mean, all Avilo did was stream a funny, tongue-in-cheek commentary for the WCS games that focused on the (im)balance of SC2. That was it.
Avilo was simply doing what he always does everyday on his stream. Yet for some reason it incited TB to explode in a fit of rage. "Avilo is TOXIC to the community!", "He MOCKED the WCS tournament organizers!" No, TB, he mocked Blizzard, and only Blizzard.
So yeah, seeing TB explode like that over a stream that really wasn't any different from what Avilo has been doing for years was kinda funny, now that I think about it. It also makes me very curious about why that particular incident set TB off the way it did.
Procrastination is the enemy
Arkansassy
Profile Joined October 2010
358 Posts
July 09 2014 18:39 GMT
#452
Codon, it's not jealously on TBs part, but pure hate and I wouldn't be surprised if TB was merely the spokesperson.

While it's TBs prerogative to dislike someone, I'm of the opinion that Team Liquid mods/admins were at the very least negligent in allowing one of its members to side-track a thread as he did with something that was irrelevant to the thread. (i.e. TB's opinion of avilo). He was permitted to incite violence upon another member with his inflammatory remarks, which is, to my knowledge, against Team Liquid's policy.. That strikes more curiosity in me than what precipitated TBs outrageous behavior.

Nevertheless, avilo has survived much worse. He is a forgiving person, who never holds a grudge.

@LingBlingBling, you are so right many terrible things have happened to avilo this year that he doesn't make public. I try my best to not judge others, because I've not walked in their shoes. Perhaps more people should try that.

codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2014-07-09 21:11:44
July 09 2014 21:09 GMT
#453
On July 10 2014 03:39 Arkansassy wrote:
Codon, it's not jealously on TBs part, but pure hate and I wouldn't be surprised if TB was merely the spokesperson.

While it's TBs prerogative to dislike someone, I'm of the opinion that Team Liquid mods/admins were at the very least negligent in allowing one of its members to side-track a thread as he did with something that was irrelevant to the thread. (i.e. TB's opinion of avilo). He was permitted to incite violence upon another member with his inflammatory remarks, which is, to my knowledge, against Team Liquid's policy.. That strikes more curiosity in me than what precipitated TBs outrageous behavior.

Nevertheless, avilo has survived much worse. He is a forgiving person, who never holds a grudge.

@LingBlingBling, you are so right many terrible things have happened to avilo this year that he doesn't make public. I try my best to not judge others, because I've not walked in their shoes. Perhaps more people should try that.


Yeah. Did you try reporting any of TBs posts? If you've been on TL for over a year you should see a report button.

By the way, did you survive the flash flooding alright?
Procrastination is the enemy
aringadingding
Profile Joined September 2010
481 Posts
July 09 2014 22:27 GMT
#454
Avilo... LOL
So, do you have any advice on being so good that you are. Or let me rephrase. How can one become as average as you are?
I guess you can answer that.
But how are you able to constantly keep up the appearance of having an IQ below 30?
Thats an interesting question.

User was temp banned for this post.
Anjellycar
Profile Blog Joined February 2012
Sweden416 Posts
Last Edited: 2014-07-10 02:04:07
July 10 2014 02:02 GMT
#455
With all due respect to everyone involved, though cannot say I'm a fan myself but I do not vocally say anything bad about Avilo or anyone else in here.

With that said I must however ask you Codon, why you still decided to put that into the OP. Granted its your choice but as a Winter, WCS, blabla other channels mod I must say this will only make things worse. I like having respectful chats and that goes for everyone, right now Avilo is a commonly mentioned player - both for good and bad. The entire SC2 community is very split on this.

Keeping Avilo out from chats is VERY extreme I admit. It's actually quite bad that it had to go that far, but as extreme as it is - it makes for the better chatroom (again, no disrespect meant) as it's avoiding that subject atleast. Here is a pastebin excerpt from WCS Europe, as it was previously mentioned being one of the places Avilo had gotten his name autotimedout from. His name was mentioned 1410 times and as previously stated this is very split amongst the viewers, both for good and for bad - but as he's not playing in the event, I dont think it's the place to discuss him. I didn't add in the command but as of late I think if Avilo can't be mentioned without causing a complete abuse-fest in chat then it's for the best it's kept out. As bad as that sounds!

Sorry for the long post, I just felt obliged when I saw the OP had been updated, Codon.
Dont worry, be happy!
Alesti
Profile Joined July 2013
Canada288 Posts
July 10 2014 03:09 GMT
#456
Banning the name of someone like that is just childish in my opinion, I mean avilo is not Hitler cmon... So what if the chat goes a little crazy, let people have their fun and they'll eventually move on to other things.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2014-07-10 07:18:59
July 10 2014 04:43 GMT
#457
On July 10 2014 11:02 Anjellycar wrote:
With all due respect to everyone involved, though cannot say I'm a fan myself but I do not vocally say anything bad about Avilo or anyone else in here.

With that said I must however ask you Codon, why you still decided to put that into the OP. Granted its your choice but as a Winter, WCS, blabla other channels mod I must say this will only make things worse. I like having respectful chats and that goes for everyone, right now Avilo is a commonly mentioned player - both for good and bad. The entire SC2 community is very split on this.

Keeping Avilo out from chats is VERY extreme I admit. It's actually quite bad that it had to go that far, but as extreme as it is - it makes for the better chatroom (again, no disrespect meant) as it's avoiding that subject atleast. Here is a pastebin excerpt from WCS Europe, as it was previously mentioned being one of the places Avilo had gotten his name autotimedout from. His name was mentioned 1410 times and as previously stated this is very split amongst the viewers, both for good and for bad - but as he's not playing in the event, I dont think it's the place to discuss him. I didn't add in the command but as of late I think if Avilo can't be mentioned without causing a complete abuse-fest in chat then it's for the best it's kept out. As bad as that sounds!

Sorry for the long post, I just felt obliged when I saw the OP had been updated, Codon.

Don't worry about your post being long. Especially considering the length of my reply.

Okay, first off, to answer your question about why I decided to put that into the OP. Well, it's quite simple, really. The fact that the mere mention of Avilo's name causes such chaos is a strong indicator that Avilo has gone from somewhat-known streamer to a well-known figure in the SC2 community. The fact that his name is being censored in such high-profile streams shows that he has passed a huge milestone in his SC2 career, which is something that any Avilo fan will want to know.
It is something that many fans have brought up in chat, and has been a very common topic of conversation in Avilo's stream chat. Since his fanclub is primarily for his fans, adding these screenshots to Avilo's fanclub was the logical thing to do, in my mind.
So there you go. That was my motivation for adding it to the fanclub.
As far as the WCS section of the post is concerned, you'll notice that I do not mention the names of any WCS moderators or organizers. I don't say anything about "nazi mods" or otherwise flame WCS or any of its organizers.
All I did was basically mention that the policy exists, and nothing more. I do not see how that can be considered to be "stirring the pot"; I mean it's not exactly a secret that WCS is doing this. Everyone already knows that they've been doing it, so how is me mentioning it a problem? If you're going to censor somebody's name completely, then it's unreasonable for you to expect that people aren't going to discuss that policy elsewhere.
In fact, you guys didn't just censor his name. You straight up BANNED him from the WCS stream chat, even though he did nothing wrong. Now how fair is that? He gets banned because other people are mean towards him? That is the ultimate heckler's veto. He's an SC2 fan just like anyone else. Did you guys not think about how maybe he'd like to be able to talk in the WCS stream-chat too?
So considering everything above, I hardly see how its unreasonable for Avilo's fanclub to mention what WCS is doing, considering that they banned him AND his name from their stream chat. If you do something so drastic to a player, it's unreasonable to expect that his fans aren't going to talk about it, and discuss it. If my posting that about WCS in his fanclub is "stirring the pot", then WCS adopting that policy is putting the pot on the stove in the first place.

Now, about Winter's stream. With WCS, I'll buy your argument about how crazy chat gets when his name is mentioned. WCS has 25k viewers, chat moves at supersonic speeds even with slowmode, I get it. The mere mention of a controversial player could cause a meltdown.
However, the same cannot be said for Winter's stream. He gets a little over 2k viewers during peak, and his chat moves quite slowly considering the number of viewers he has. Heck, I've seen 500-viewer streams with faster-moving chats.
So the argument about chat being "uncontrollable" if Avilo's name isn't censored simply does not apply. I mean seriously? You're telling me that like 5+ mods can't keep that chat under control? Nope, not buying it.
I've got a decent amount of modding experience under my belt, and I've modded Avilo's chat when it was "out of control" plenty of times, and I can tell you right now that there is no way Winter's chat would get uncontrollable if someone were to mention Avilo. Seriously. AviloHater and AviloFan get into argument over Avilo, and you're telling me that you can't just TO the one who crosses the line? It's not that hard at all. Even though winter gets slightly more viewers than Avilo, his chat moves significantly more slowly, and there is simply no you'll have me believe that his mods wouldn't be able to manage an argument between AviloFan and AviloHater. Please note that I'm not criticizing his mods; they're just doing their job by enforcing his rules. However, if Winter is going to adopt a policy that is quite frankly ridiculous, then others are going to mock it.
I don't hate Winter, in fact I do watch him quite frequently and think he's a good streamer and all, but I do feel that censoring Avilo's name instead of simply taking the few seconds required to discipline the viewers who actually cross the line discussing him is just an incredible cop-out.
Procrastination is the enemy
KMFDM
Profile Joined February 2014
9 Posts
July 10 2014 13:12 GMT
#458
I was wondering if anyone had a vod of the cast he did about the WCS PvP finals?

(I found it quite funny and would love to see it again, specially since I only saw half of it)

I can't find the VoD on his stream.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 10 2014 16:37 GMT
#459
On July 10 2014 22:12 KMFDM wrote:
I was wondering if anyone had a vod of the cast he did about the WCS PvP finals?

(I found it quite funny and would love to see it again, specially since I only saw half of it)

I can't find the VoD on his stream.

I will ask him about the vod and see if I can find it.
Procrastination is the enemy
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2014-07-10 18:31:20
July 10 2014 18:28 GMT
#460
Hellooo Avibrovilos!
Avilo recently appeared on the Unfiltered show with TotalBiscuit to talk about the state of SC2 (and how toxic he is for the community aviKappa). I've gone ahead and added vods of his appearance to the fanclub.

I also went ahead and did a bit of photoshopping and added this image to the article about AviCensorship.
[image loading]
Enjoy! And remember, don't say his name! It's jinxed. + Show Spoiler +
Just kidding.
Procrastination is the enemy
Arkansassy
Profile Joined October 2010
358 Posts
July 10 2014 22:05 GMT
#461
To those who know avilo - his fans, his viewers, I was sent this rather misleading tweet today:

TotalBiscuit @Totalbiscuit · 20h

"Point about Avilo's toxicity successfully proven beyond a shadow of a doubt. Not been told to kill myself that much in a long time."

Obviously, we know that avilo never told this person to "kill himself;" however, that is what was implied. Even those people in chat, who made derogatory comments about the above named person were warned to stop by both mods and avilo.

Insulting another streamer/person so as to damage his reputation is strictly forbidden in avilo's chat, as stated in the house rules. We also discourage avilo's viewers from spamming or harassing other streamers. Several of avilo's regular viewers have been banned, when reported with evidence, due to such conduct.

It's just too bad that other streamers and their mods don't adhere to the same policy. So much for community.
THEPPLsELBOW
Profile Joined November 2010
United States190 Posts
July 10 2014 22:46 GMT
#462
Just want to say I appreciate what Avilo has done and is still doing for the community. It sucks that he gets so much hate but props to him and Arkansassy for keeping their head up! Personally, I watch Avilo because its awesome (and really funny) every time he wins vs protoss, and each loss he does a good job explaining what went wrong. Best thing he showed us was his raven-viking vs carrier micro. That's one of the few things a viewer would have no idea whats going on unless he broke it down and explained it step by step, its helped my late game PvT a lot.

And probably the highlight for the stream entertainment wise was when Avilo won vs a protoss, someone on stream said something along the lines of... Calm down Avilo you won one game....

And then Avilo was like....

"wow, you know what I say to that?"

"you know what I say to that motherfucker???"

and I was totally expecting some flashy ban

But then he goes on spotify or grooveshark or whatever, and starts playing "Celebrate(good times cmon!)"

And was totally chill about it and was like, dude I just beat PROTOSS! You gotta cherish each and everyone of these things!!!

#herowedeserve
starslayer
Profile Joined August 2011
United States696 Posts
Last Edited: 2014-07-11 05:18:53
July 11 2014 05:15 GMT
#463
was bored and was surfing the web trying to find other web site for starcraft and got this in google thought its kinda funny out of everything that could have been brought up and this came up.

http://i.imgur.com/29KMeNI.png

i came here to kickass and chew bubblegum and i'm all out of bubble gum
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2014-07-11 05:21:09
July 11 2014 05:20 GMT
#464
On July 11 2014 14:15 starslayer wrote:
was bored and was surfing the web trying to find other web site for starcraft and got this in google thought its kinda funny out of everything that could have been brought up and this came up.

http://i.imgur.com/29KMeNI.png


Damn, seriously? Is that on the first page?

That's going in the fanclub asap. Avilo's made it onto the first page of google!

Thanks man aviRaven
Procrastination is the enemy
KMFDM
Profile Joined February 2014
9 Posts
July 11 2014 19:27 GMT
#465
On July 11 2014 01:37 codonbyte wrote:
Show nested quote +
On July 10 2014 22:12 KMFDM wrote:
I was wondering if anyone had a vod of the cast he did about the WCS PvP finals?

(I found it quite funny and would love to see it again, specially since I only saw half of it)

I can't find the VoD on his stream.

I will ask him about the vod and see if I can find it.


Any luck?
aeligos
Profile Joined January 2013
United States172 Posts
July 12 2014 02:05 GMT
#466
Commander Avilo!

We who are Terran salute you!

o7
libera te tvtemet ex inferis A.'.A.'.
Genus.KhaoTiK
Profile Joined June 2014
United States9 Posts
July 12 2014 02:19 GMT
#467
avilo is a beautiful metaphorical dragon that doesn't eat lions- even if they scratch his balls.
"This mouse mat is not nearly as soft or supple as the skin of ten thousand fan girls, but I suppose it is acceptable." - Jaedong
starslayer
Profile Joined August 2011
United States696 Posts
Last Edited: 2014-07-12 02:42:37
July 12 2014 02:40 GMT
#468
On July 11 2014 14:20 codonbyte wrote:
Show nested quote +
On July 11 2014 14:15 starslayer wrote:
was bored and was surfing the web trying to find other web site for starcraft and got this in google thought its kinda funny out of everything that could have been brought up and this came up.

http://i.imgur.com/29KMeNI.png


Damn, seriously? Is that on the first page?

That's going in the fanclub asap. Avilo's made it onto the first page of google!

Thanks man aviRaven

yep thats the first page only a couple links down just searched starcraft 2 find twitchtv and it will have avilos "mech kung fu thing" lol

lol also just typed in starcraft twitch into google and again it pops out as the first link lol avilo stepping it up in the world
i came here to kickass and chew bubblegum and i'm all out of bubble gum
Kevin_Sorbo
Profile Joined November 2011
Canada3217 Posts
July 12 2014 15:29 GMT
#469
Avilo Mulder, THE TRUTH IS OUT THERE
The mind is like a parachute, it doesnt work unless its open. - Zappa
starslayer
Profile Joined August 2011
United States696 Posts
July 12 2014 23:33 GMT
#470
http://msibeatit.com/tournaments/starcraft-2-american-qualifier-2/ join this, no one is really in this and its really big money and paid trip and everything plz. i really think you could win it if you still want to try tourneys if not all good.
i came here to kickass and chew bubblegum and i'm all out of bubble gum
eightym
Profile Joined May 2011
United States76 Posts
July 13 2014 17:22 GMT
#471
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 13 2014 18:45 GMT
#472
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit

Sadly, I think a lot of people become jerks after becoming famous and successful. You see it all the time with hollywood stars, and esports is really no different if you think about it.

I'm glad that his actions did incite such a negative reaction from the community, even from many people who aren't Avilo fans. Gives me some faith in the community.
Procrastination is the enemy
Kevin_Sorbo
Profile Joined November 2011
Canada3217 Posts
July 13 2014 19:59 GMT
#473
even if he is a douche you cannot deny the fact that TB has done more things for this community than Avilos balance talk will ever do...

His last shoutcraft event was superb. His team is a pro organisation.

But you guys are right, I really despise the way he bullies people on the Internet lol
The mind is like a parachute, it doesnt work unless its open. - Zappa
TotalBiscuit
Profile Blog Joined March 2010
United Kingdom5437 Posts
July 13 2014 22:27 GMT
#474
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit


Saw it.

Adding it to the mountains of evidence of Avilo fans toxicity. Thanks.
CommentatorHost of SHOUTcraft Clan Wars- http://www.mlg.tv/shoutcraft
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 14 2014 00:09 GMT
#475
On July 14 2014 07:27 TotalBiscuit wrote:
Show nested quote +
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit


Saw it.

Adding it to the mountains of evidence of Avilo fans toxicity. Thanks.

So anyone who criticizes you for your behavior is toxic. I see how it is. It never occurred to you that maybe some people were reacting to your history of behavior, and could care less about Avilo. Also, how is that post evidence of Avilo fan toxicity? Eightym was perfectly civilized.
Procrastination is the enemy
PanN
Profile Blog Joined December 2008
United States2828 Posts
July 14 2014 00:15 GMT
#476
On July 14 2014 09:09 codonbyte wrote:
Show nested quote +
On July 14 2014 07:27 TotalBiscuit wrote:
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit


Saw it.

Adding it to the mountains of evidence of Avilo fans toxicity. Thanks.

So anyone who criticizes you for your behavior is toxic. I see how it is. It never occurred to you that maybe some people were reacting to your history of behavior, and could care less about Avilo. Also, how is that post evidence of Avilo fan toxicity? Eightym was perfectly civilized.


Uhh, I wouldn't call it perfectly civilized.
We have multiple brackets generated in advance. Relax . (Kennigit) I just simply do not understand how it can be the time to play can be 22nd at 9:30 pm PST / midnight the 23rd at the same time. (GGzerg)
Shebuha
Profile Blog Joined May 2011
Canada1335 Posts
July 14 2014 00:17 GMT
#477
On July 14 2014 09:15 PanN wrote:
Show nested quote +
On July 14 2014 09:09 codonbyte wrote:
On July 14 2014 07:27 TotalBiscuit wrote:
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit


Saw it.

Adding it to the mountains of evidence of Avilo fans toxicity. Thanks.

So anyone who criticizes you for your behavior is toxic. I see how it is. It never occurred to you that maybe some people were reacting to your history of behavior, and could care less about Avilo. Also, how is that post evidence of Avilo fan toxicity? Eightym was perfectly civilized.


Uhh, I wouldn't call it perfectly civilized.

hahaaahhahaahahahahahah truth
eightym
Profile Joined May 2011
United States76 Posts
Last Edited: 2014-07-14 00:22:50
July 14 2014 00:22 GMT
#478
On July 14 2014 07:27 TotalBiscuit wrote:
Show nested quote +
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit


Saw it.

Adding it to the mountains of evidence of Avilo fans toxicity. Thanks.


Criticizing your questionable behavior isn't toxicity, TotalBiscuit. It's called criticism.

edit: BTW, get well soon. I mean that.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 14 2014 00:23 GMT
#479
On July 14 2014 09:15 PanN wrote:
Show nested quote +
On July 14 2014 09:09 codonbyte wrote:
On July 14 2014 07:27 TotalBiscuit wrote:
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit


Saw it.

Adding it to the mountains of evidence of Avilo fans toxicity. Thanks.

So anyone who criticizes you for your behavior is toxic. I see how it is. It never occurred to you that maybe some people were reacting to your history of behavior, and could care less about Avilo. Also, how is that post evidence of Avilo fan toxicity? Eightym was perfectly civilized.


Uhh, I wouldn't call it perfectly civilized.

Maybe not. But "not perfectly civilized" != "toxic to the community".

Also, how is it uncivilized? He doesn't flame TB at all. Just criticizes his behavior.
Procrastination is the enemy
PanN
Profile Blog Joined December 2008
United States2828 Posts
July 14 2014 00:24 GMT
#480
On July 14 2014 09:22 eightym wrote:
Show nested quote +
On July 14 2014 07:27 TotalBiscuit wrote:
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit


Saw it.

Adding it to the mountains of evidence of Avilo fans toxicity. Thanks.


Criticizing your questionable behavior isn't toxicity, TotalBiscuit. It's called criticism.

edit: BTW, get well soon. I mean that.


"He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance)."

That may be what you call criticism, but its certainly not constructive. RuFF is an asshole and deserves every single thing that he got the moment he shit on somebody for having a disease. TB's not trying to ruin avilos career. You basically just said a bunch of things in the same ignorant light that you tried to paint TB with. Yeah, you guys got fan vision on hard.
We have multiple brackets generated in advance. Relax . (Kennigit) I just simply do not understand how it can be the time to play can be 22nd at 9:30 pm PST / midnight the 23rd at the same time. (GGzerg)
eightym
Profile Joined May 2011
United States76 Posts
July 14 2014 00:26 GMT
#481
On July 14 2014 09:15 PanN wrote:
Show nested quote +
On July 14 2014 09:09 codonbyte wrote:
On July 14 2014 07:27 TotalBiscuit wrote:
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit


Saw it.

Adding it to the mountains of evidence of Avilo fans toxicity. Thanks.

So anyone who criticizes you for your behavior is toxic. I see how it is. It never occurred to you that maybe some people were reacting to your history of behavior, and could care less about Avilo. Also, how is that post evidence of Avilo fan toxicity? Eightym was perfectly civilized.


Uhh, I wouldn't call it perfectly civilized.


Don't blame me. Blame TB. His toxicity made me rage
PanN
Profile Blog Joined December 2008
United States2828 Posts
July 14 2014 00:27 GMT
#482
On July 14 2014 09:26 eightym wrote:
Show nested quote +
On July 14 2014 09:15 PanN wrote:
On July 14 2014 09:09 codonbyte wrote:
On July 14 2014 07:27 TotalBiscuit wrote:
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit


Saw it.

Adding it to the mountains of evidence of Avilo fans toxicity. Thanks.

So anyone who criticizes you for your behavior is toxic. I see how it is. It never occurred to you that maybe some people were reacting to your history of behavior, and could care less about Avilo. Also, how is that post evidence of Avilo fan toxicity? Eightym was perfectly civilized.


Uhh, I wouldn't call it perfectly civilized.


Don't blame me. Blame TB. His toxicity made me rage


I'm not blaming anybody. Just don't act like a perfect little angel with your poking stick hiding behind your back and corroded smile.
We have multiple brackets generated in advance. Relax . (Kennigit) I just simply do not understand how it can be the time to play can be 22nd at 9:30 pm PST / midnight the 23rd at the same time. (GGzerg)
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 14 2014 00:28 GMT
#483
On July 14 2014 09:24 PanN wrote:
Show nested quote +
On July 14 2014 09:22 eightym wrote:
On July 14 2014 07:27 TotalBiscuit wrote:
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit


Saw it.

Adding it to the mountains of evidence of Avilo fans toxicity. Thanks.


Criticizing your questionable behavior isn't toxicity, TotalBiscuit. It's called criticism.

edit: BTW, get well soon. I mean that.


"He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance)."

That may be what you call criticism, but its certainly not constructive. RuFF is an asshole and deserves every single thing that he got the moment he shit on somebody for having a disease. TB's not trying to ruin avilos career. You basically just said a bunch of things in the same ignorant light that you tried to paint TB with. Yeah, you guys got fan vision on hard.

Fan vision? Maybe we have fan vision because you are in Avilo's fan club. What are you doing in here anyway if you aren't a fan of Avilo? You know, it gets mighty tiresome to constantly get flamed simply for being fans of Avilo. "Oh you've got fan vision", "oh you're just a bunch of pathetic fanbois blindly sticking up for your lord and savior".

It gets old mighty fast. People don't even bother responding to our points. They simply pull out the "oh you're a fanboi therefore what you say is invalid" card.

Seriously, if you're not a fan of Avilo please don't post here.
Procrastination is the enemy
showstealer1829
Profile Blog Joined May 2014
Australia3123 Posts
July 14 2014 00:47 GMT
#484
On July 14 2014 09:28 codonbyte wrote:
Show nested quote +
On July 14 2014 09:24 PanN wrote:
On July 14 2014 09:22 eightym wrote:
On July 14 2014 07:27 TotalBiscuit wrote:
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit


Saw it.

Adding it to the mountains of evidence of Avilo fans toxicity. Thanks.


Criticizing your questionable behavior isn't toxicity, TotalBiscuit. It's called criticism.

edit: BTW, get well soon. I mean that.


"He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance)."

That may be what you call criticism, but its certainly not constructive. RuFF is an asshole and deserves every single thing that he got the moment he shit on somebody for having a disease. TB's not trying to ruin avilos career. You basically just said a bunch of things in the same ignorant light that you tried to paint TB with. Yeah, you guys got fan vision on hard.

Fan vision? Maybe we have fan vision because you are in Avilo's fan club. What are you doing in here anyway if you aren't a fan of Avilo? You know, it gets mighty tiresome to constantly get flamed simply for being fans of Avilo. "Oh you've got fan vision", "oh you're just a bunch of pathetic fanbois blindly sticking up for your lord and savior".

It gets old mighty fast. People don't even bother responding to our points. They simply pull out the "oh you're a fanboi therefore what you say is invalid" card.

Seriously, if you're not a fan of Avilo please don't post here.


"People never respond to our points."

"Seriously, if you're not a fan of Avilo please don't post here"

Avilo fan logic 101 in full view
There is no understanding. There is only Choya. Choya is the way. Choya is Love. Choya is Life. Has is the Light in the Protoss Dark and Nightmare is his chosen Acolyte
PanN
Profile Blog Joined December 2008
United States2828 Posts
Last Edited: 2014-07-14 00:50:21
July 14 2014 00:48 GMT
#485
On July 14 2014 09:28 codonbyte wrote:
Show nested quote +
On July 14 2014 09:24 PanN wrote:
On July 14 2014 09:22 eightym wrote:
On July 14 2014 07:27 TotalBiscuit wrote:
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit


Saw it.

Adding it to the mountains of evidence of Avilo fans toxicity. Thanks.


Criticizing your questionable behavior isn't toxicity, TotalBiscuit. It's called criticism.

edit: BTW, get well soon. I mean that.


"He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance)."

That may be what you call criticism, but its certainly not constructive. RuFF is an asshole and deserves every single thing that he got the moment he shit on somebody for having a disease. TB's not trying to ruin avilos career. You basically just said a bunch of things in the same ignorant light that you tried to paint TB with. Yeah, you guys got fan vision on hard.

Fan vision? Maybe we have fan vision because you are in Avilo's fan club. What are you doing in here anyway if you aren't a fan of Avilo? You know, it gets mighty tiresome to constantly get flamed simply for being fans of Avilo. "Oh you've got fan vision", "oh you're just a bunch of pathetic fanbois blindly sticking up for your lord and savior".

It gets old mighty fast. People don't even bother responding to our points. They simply pull out the "oh you're a fanboi therefore what you say is invalid" card.

Seriously, if you're not a fan of Avilo please don't post here.


I'm absolutely aware of where I'm at. You're just further proving my point. Quit taking things so personally and maybe you won't get offended as often. He in his mind thought he was offering something constructive, when in reality it was just a rant. I just called him on it is all. As did TB. You both come to defend again, fan vision in my eyes.

You have absolutely 0 clue as to who I am a fan of and not a fan of. Don't assume things - it's a bad habit. I've been watching avilo for a long time now and see the good and bad in him, I consider my self a fan, but a realistic one. Dudes entertaining, but the dude has flaws. I'm not going to pretend like he does/doesn't and feel extreme one way or the other. Haven't you ever liked somebody but disliked things about them? Yeah thats how I feel about Avilo. His unnecessary rage, his map hacking assumptions / stream cheating assumptions, his auto-leaves vs protoss, his needless moments of over dramatic defeat, his general ego all annoy me a lot. But he's good, can be funny, very informative, commentates non-stop, plays are unique, free kungfu lessons, has an immense amount of passion, and best of all, has a genuine LOVE for the game. I'm not flaming you at all, I'm not upset that you're a fan of avilo - it don't bother me, but yeah to quote you I do feel like a lot of you blindly defend him. People attack him blindly ten times more often then hes defended, and it sucks. But a lot of you really do act as if he's perfect, and if you like him, you should know that doesn't exactly help him right?

My absolute favorite moment with avilo so far though is his appearance on unfiltered. You catch that love and then some just watching it, and he just waded through everybody's bullshit and kept trying. He wanted to talk about the game, they wanted to talk about Avilo, but in the end maybe both got their way. His attitude on the show was phenomenal.

But he's an asshole sometimes. Thats just a fact. And because I said so doesn't mean I don't like the guy, i'd just like a little more honesty
We have multiple brackets generated in advance. Relax . (Kennigit) I just simply do not understand how it can be the time to play can be 22nd at 9:30 pm PST / midnight the 23rd at the same time. (GGzerg)
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2014-07-14 01:12:12
July 14 2014 01:07 GMT
#486
On July 14 2014 09:48 PanN wrote:
Show nested quote +
On July 14 2014 09:28 codonbyte wrote:
On July 14 2014 09:24 PanN wrote:
On July 14 2014 09:22 eightym wrote:
On July 14 2014 07:27 TotalBiscuit wrote:
On July 14 2014 02:22 eightym wrote:
TB thinks he's a god of starcraft who can choose who leaves and who stays. When the community reacts negatively towards him? He just blames it on avilo... over and over.

He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance).

TB has changed a lot recently and I hope he loses all his fans. Being sick is not an excuse to be hateful and unfair. It's sad, I used to like him a lot. But he treats innocent people like this and that's disgusting. He's so ignorant...

btw, so he reads this: TotalBiscuit


Saw it.

Adding it to the mountains of evidence of Avilo fans toxicity. Thanks.


Criticizing your questionable behavior isn't toxicity, TotalBiscuit. It's called criticism.

edit: BTW, get well soon. I mean that.


"He thinks because he throws money at his "top Korean team" (LUL) that he has authority on the gameplay of starcraft. He comes in, completely ignorant, spouting generic rhetoric he has fine tuned over the past decade as an internet narcissist personality. Then he shitposts on twitter to rally all his pathetic non-sc2 fans behind him. EVERY. TIME. He tried to ruin RuFF's career (for being BM on ladder) and now he's trying to ruin avilo's (for complaining about balance)."

That may be what you call criticism, but its certainly not constructive. RuFF is an asshole and deserves every single thing that he got the moment he shit on somebody for having a disease. TB's not trying to ruin avilos career. You basically just said a bunch of things in the same ignorant light that you tried to paint TB with. Yeah, you guys got fan vision on hard.

Fan vision? Maybe we have fan vision because you are in Avilo's fan club. What are you doing in here anyway if you aren't a fan of Avilo? You know, it gets mighty tiresome to constantly get flamed simply for being fans of Avilo. "Oh you've got fan vision", "oh you're just a bunch of pathetic fanbois blindly sticking up for your lord and savior".

It gets old mighty fast. People don't even bother responding to our points. They simply pull out the "oh you're a fanboi therefore what you say is invalid" card.

Seriously, if you're not a fan of Avilo please don't post here.


I'm absolutely aware of where I'm at. You're just further proving my point. Quit taking things so personally and maybe you won't get offended as often. He in his mind thought he was offering something constructive, when in reality it was just a rant. I just called him on it is all. As did TB. You both come to defend again, fan vision in my eyes.

You have absolutely 0 clue as to who I am a fan of and not a fan of. Don't assume things - it's a bad habit. I've been watching avilo for a long time now and see the good and bad in him, I consider my self a fan, but a realistic one. Dudes entertaining, but the dude has flaws. I'm not going to pretend like he does/doesn't and feel extreme one way or the other. Haven't you ever liked somebody but disliked things about them? Yeah thats how I feel about Avilo. His unnecessary rage, his map hacking assumptions / stream cheating assumptions, his auto-leaves vs protoss, his needless moments of over dramatic defeat, his general ego all annoy me a lot. But he's good, can be funny, very informative, commentates non-stop, plays are unique, free kungfu lessons, has an immense amount of passion, and best of all, has a genuine LOVE for the game. I'm not flaming you at all, I'm not upset that you're a fan of avilo - it don't bother me, but yeah to quote you I do feel like a lot of you blindly defend him. People attack him blindly ten times more often then hes defended, and it sucks. But a lot of you really do act as if he's perfect, and if you like him, you should know that doesn't exactly help him right?

My absolute favorite moment with avilo so far though is his appearance on unfiltered. You catch that love and then some just watching it, and he just waded through everybody's bullshit and kept trying. He wanted to talk about the game, they wanted to talk about Avilo, but in the end maybe both got their way. His attitude on the show was phenomenal.

But he's an asshole sometimes. Thats just a fact. And because I said so doesn't mean I don't like the guy, i'd just like a little more honesty

Okay man. Sorry I jumped to conclusions about you. I guess I just got a bit paranoid after being attacked and mocked by TB in an LR thread, got called a cunt in several PMs from some random user simply for being an Avilo fan, got a random death-threat in a twitch stream chat (forget which one), etc. etc.

I guess all those things happening made me a bit paranoid, and I jumped to conclusions. For that I apologize.

As for the other things you say, first let me say that I am not blind to the fact that Avilo has flaws. Yes, he does rage at his opponents sometimes, and he shouldn't. It's not a good thing to do, which leads to one of the other criticisms you had of him:
That he auto-leaves vs Protoss. This is something I'm actually going to defend. Why? Well, the reason he does it is because he's trying to work on the first criticism. He's trying not to rage. And he's found that TvP tends to make him rage. So he's making a HUGE sacrifice to try and curb his raging. I mean auto-losing 1 out of 3 matches does not do pretty things to your MMR, but it is helping him not rage as much. So while yes, obviously it would be ideal for him to be able to not rage even when playing TvPs, you have to give him some credit for acknowledging his own weakness and taking the steps necessary to curb his raging.

Now as for your point about him constantly accusing others of stream-cheating/map-hacking:

Yes, I agree that sometimes he jumps to conclusions about his opponents, and that jumping to conclusions is not a good thing to do (hence why I apologized for jumping to conclusions about you). However, I really can't hold that against him because I've seen too many streams get completely shut down by stream cheaters. I've seen it happen to Artosis, Nathanias and Brentstarcraft, and even lesser-known streamers like LivinPink and ChicksTV. Heck, chickstv once had a stream-sniper who would stalk her when she wasn't streaming, and I've seen Artosis get repeatedly stream-sniped on multiple different occasions, one of which was followed up by a DDos.

Oh yeah, and I've seen Avilo get repeatedly stream-sniped by known map-hackers, and I've seen him get stream-sniped by random barcode accounts and then for the barcode account to reveal that it is, in fact, a smurf of the known map-hacker responsible for the former-mentioned stream-snipes (you've heard of Nerffy, right?).

And each of these incidents causes enough damage to the streamer's stream that I simply cannot blame them for being paranoid, even though I recognize that it is not good to jump to conclusions about people without proper evidence.

So there you have it PanN: just as my assumptions about you were false, your assumptions about me were also false. I'm fully aware that Avilo has his faults. But you know what? I think that he's still a pretty awesome guy, and a very talented and innovative SC2 player who has incredible patience and late-game sense. And the reason I don't bring up his faults is because he has 1349861 haters who do it all the time, and I've always felt that with that many haters constantly bringing them up and spouting insults at him, it would be most unnecessary for me to do so as well.

Edit: TB didn't "just" call Avilo on his faults: TB called Avilo toxic, and also said, in the LR thread where he made his comments about Avilo being toxic for the community, that anyone who's a fan of Avilo is also toxic for the community. So no, while I rescind what I originally said about you, I will not rescind what I said about TB, because TB made some extreme blanket statements about people who he knows nothing about. People like you, who are fans of Avilo who recognize that he, like everyone else, has faults.
Procrastination is the enemy
TotalBiscuit
Profile Blog Joined March 2010
United Kingdom5437 Posts
July 14 2014 01:41 GMT
#487
He thinks because he throws money at his "top Korean team" (LUL)


completely ignorant


internet narcissist


he shitposts on twitter to rally all his pathetic non-sc2 fans behind him.


I hope he loses all his fans


He's so ignorant...


------------

perfectly civilized


He doesn't flame TB at all.



I rest my case.
CommentatorHost of SHOUTcraft Clan Wars- http://www.mlg.tv/shoutcraft
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 14 2014 01:43 GMT
#488
On July 14 2014 10:41 TotalBiscuit wrote:
Show nested quote +
He thinks because he throws money at his "top Korean team" (LUL)


Show nested quote +
completely ignorant


Show nested quote +
internet narcissist


Show nested quote +
he shitposts on twitter to rally all his pathetic non-sc2 fans behind him.


Show nested quote +
I hope he loses all his fans


Show nested quote +
He's so ignorant...


------------

Show nested quote +
perfectly civilized


Show nested quote +
He doesn't flame TB at all.



I rest my case.

Do you care to actually refute what he said? Because as it stands right now all you did was call him toxic. You never actually explained why those things he said about you are not true.
Procrastination is the enemy
TotalBiscuit
Profile Blog Joined March 2010
United Kingdom5437 Posts
July 14 2014 02:31 GMT
#489
On July 14 2014 10:43 codonbyte wrote:
Show nested quote +
On July 14 2014 10:41 TotalBiscuit wrote:
He thinks because he throws money at his "top Korean team" (LUL)


completely ignorant


internet narcissist


he shitposts on twitter to rally all his pathetic non-sc2 fans behind him.


I hope he loses all his fans


He's so ignorant...


------------

perfectly civilized


He doesn't flame TB at all.



I rest my case.

Do you care to actually refute what he said? Because as it stands right now all you did was call him toxic. You never actually explained why those things he said about you are not true.


No, I'd rather we get back to talking about the game. Can we just get back on topic here and talk about the balance?
CommentatorHost of SHOUTcraft Clan Wars- http://www.mlg.tv/shoutcraft
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2014-07-14 02:52:57
July 14 2014 02:41 GMT
#490
On July 14 2014 11:31 TotalBiscuit wrote:
Show nested quote +
On July 14 2014 10:43 codonbyte wrote:
On July 14 2014 10:41 TotalBiscuit wrote:
He thinks because he throws money at his "top Korean team" (LUL)


completely ignorant


internet narcissist


he shitposts on twitter to rally all his pathetic non-sc2 fans behind him.


I hope he loses all his fans


He's so ignorant...


------------

perfectly civilized


He doesn't flame TB at all.



I rest my case.

Do you care to actually refute what he said? Because as it stands right now all you did was call him toxic. You never actually explained why those things he said about you are not true.


No, I'd rather we get back to talking about the game. Can we just get back on topic here and talk about the balance?

Absolutely! I'd be delighted to talk about the game with you, and I'm sure Avilo would too.

What are your thoughts on the current balance of the game?
Procrastination is the enemy
Onekobold
Profile Blog Joined October 2013
244 Posts
July 14 2014 04:45 GMT
#491
--- Nuked ---
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 14 2014 05:03 GMT
#492
On July 14 2014 13:45 Onekobold wrote:
Show nested quote +
On July 14 2014 11:31 TotalBiscuit wrote:
On July 14 2014 10:43 codonbyte wrote:
Do you care to actually refute what he said? Because as it stands right now all you did was call him toxic. You never actually explained why those things he said about you are not true.


No, I'd rather we get back to talking about the game. Can we just get back on topic here and talk about the balance?


wrecked

Oh really? Is that so?
Well somebody got wrecked, but it sure as hell wasn't me. If you'd actually read the thread, you'll notice that TotalBiscuit was never talking about the game in the first place. Also, if you had followed the situation and actually knew what you were talking about, you'd know that somebody wanted nothing more than to talk about the game on the Unfiltered show, and that a certain somebody else kept derailing the conversation. Now who do you suppose was the one derailing the conversation? I'll give you a hint: it starts with "T" and ends with "iscuit".
Procrastination is the enemy
Onekobold
Profile Blog Joined October 2013
244 Posts
July 14 2014 22:36 GMT
#493
--- Nuked ---
Arkansassy
Profile Joined October 2010
358 Posts
July 15 2014 01:34 GMT
#494
Please keep this FAN CLUB civil. Haters have other avenues upon which to hate on someone - THIS IS NOT THE PLACE. This is avilo's FAN CLUB. If you want to hate on him, kindly do it elsewhere!

Thank you
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 15 2014 01:44 GMT
#495
On July 15 2014 10:34 Arkansassy wrote:
Please keep this FAN CLUB civil. Haters have other avenues upon which to hate on someone - THIS IS NOT THE PLACE. This is avilo's FAN CLUB. If you want to hate on him, kindly do it elsewhere!

Thank you

I tried reporting some of the posts that were hating on him, but nothing happened . I thought fanclubs were supposed to be holy ground?
Procrastination is the enemy
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2014-07-15 02:04:03
July 15 2014 02:03 GMT
#496
I reported them as well. It depends on the fairness of the mods at the time. Most of them can see what is happening here and should not allow it to happen. A fan club is for FANS not for haters! How bright does a person have to be to realize that "fanbois" will be in a fan club? *shrugs
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 15 2014 02:50 GMT
#497
On July 15 2014 11:03 Arkansassy wrote:
I reported them as well. It depends on the fairness of the mods at the time. Most of them can see what is happening here and should not allow it to happen. A fan club is for FANS not for haters! How bright does a person have to be to realize that "fanbois" will be in a fan club? *shrugs

I've considered asking to have this fanclub moved to blogs. It wouldn't be ideal to not have it in the Fanclubs sub-forum, but by having it in the Blogs section, I could actually ban users from posting in here at my discretion. I'd be curious to know what you and Avilo would think of that. Of course, I don't know if TL would be willing to do that, but it's just a thought I had.
Procrastination is the enemy
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
July 17 2014 02:02 GMT
#498
People, it is time to acknowledge that Avilo is basically the Orwell and Nastrodaumus of Starcraft2

The Campaign is working!

http://us.battle.net/sc2/en/blog/14834353
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
Klimax
Profile Joined August 2010
United States5 Posts
July 17 2014 03:28 GMT
#499
Id like to be in the fan club too! just seen the 3 hour wcs game. crazy! (jamesklimas on twitch)
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 17 2014 05:09 GMT
#500
On July 17 2014 12:28 Klimax wrote:
Id like to be in the fan club too! just seen the 3 hour wcs game. crazy! (jamesklimas on twitch)

Added! And yes, that three hour and fifteen minute game was a perfect example of why Avilo's fans like him so much. Most players don't often play games that last longer than 40 minutes, but just about every Avilo game lasts past the 45 minute mark.
Procrastination is the enemy
mantequilla
Profile Blog Joined June 2012
Turkey781 Posts
July 17 2014 08:04 GMT
#501
What happened at the end of 2:30+ hour WCS qualifier TvZ match? Went to bed after 2:30.
Age of Mythology forever!
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 17 2014 08:29 GMT
#502
On July 17 2014 17:04 mantequilla wrote:
What happened at the end of 2:30+ hour WCS qualifier TvZ match? Went to bed after 2:30.

It was almost a draw, but zerg was able to chase him into a corner and he wasn't quite able to keep his ravens out of fungle range with his buildings floating in the corner. It was an epic game that went on for three hours and fifteen minutes.
Procrastination is the enemy
showstealer1829
Profile Blog Joined May 2014
Australia3123 Posts
July 17 2014 08:44 GMT
#503
If by "epic" you mean "Killing Esports one cut at a time"
There is no understanding. There is only Choya. Choya is the way. Choya is Love. Choya is Life. Has is the Light in the Protoss Dark and Nightmare is his chosen Acolyte
HelpMeGetBetter
Profile Blog Joined November 2012
United States764 Posts
Last Edited: 2014-07-17 13:35:47
July 17 2014 13:35 GMT
#504
Like him or not, Avilo is totally right when he says not to blame the players for that game. We could look back years from now and say that single unit (SH) killed this game.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 17 2014 13:55 GMT
#505
On July 17 2014 17:44 showstealer1829 wrote:
If by "epic" you mean "Killing Esports one cut at a time"

Different people have different preferences when it comes to games, you know. We Avilo fans like our games long and our armies maxed, so
Procrastination is the enemy
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2014-07-18 11:13:54
July 18 2014 10:50 GMT
#506
I've been completely overhauling the fanclub to improve it's organization. For starters, I've added several notable vods to the fanclub, including the VOD of that epic three hour game vs Patton! Click herefor a link to that vod.

Make sure to get your supersize popcorn and supersize rootbeer ready, because you're gonna be there for a loooong time. Enjoy!

Edit: I also added some streams to the list of livestreams that time out users who discuss Avilo in chat. If you get purged for discussing Avilo in a stream chat, please post about it here (preferably including a screenshot), and I'll add it to the list.
Procrastination is the enemy
mantequilla
Profile Blog Joined June 2012
Turkey781 Posts
July 18 2014 11:12 GMT
#507
On July 17 2014 17:29 codonbyte wrote:
Show nested quote +
On July 17 2014 17:04 mantequilla wrote:
What happened at the end of 2:30+ hour WCS qualifier TvZ match? Went to bed after 2:30.

It was almost a draw, but zerg was able to chase him into a corner and he wasn't quite able to keep his ravens out of fungle range with his buildings floating in the corner. It was an epic game that went on for three hours and fifteen minutes.



Did he win the series?
Age of Mythology forever!
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2014-07-18 11:52:33
July 18 2014 11:15 GMT
#508
On July 18 2014 20:12 mantequilla wrote:
Show nested quote +
On July 17 2014 17:29 codonbyte wrote:
On July 17 2014 17:04 mantequilla wrote:
What happened at the end of 2:30+ hour WCS qualifier TvZ match? Went to bed after 2:30.

It was almost a draw, but zerg was able to chase him into a corner and he wasn't quite able to keep his ravens out of fungle range with his buildings floating in the corner. It was an epic game that went on for three hours and fifteen minutes.



Did he win the series?

No, he lost the series vs Patton in the second round. He lost the first game to Patton because he went for an early reactor without having any units behind his wall-in and zerg was able to break down his wall with a 10 pool. Avilo lost too many SCVs to win that game. The second game was the epic 3-hour game, and he just barely lost that one as well. Still an epic game though.
Procrastination is the enemy
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 18 2014 18:02 GMT
#509
Avilo is streaming now! Come check him out here!!
Procrastination is the enemy
Aeromi
Profile Blog Joined August 2012
France14461 Posts
July 18 2014 19:32 GMT
#510
Is Avilo fulltime ?
https://twitter.com/DrAeromi | Updates on live tournaments: @StarCrafteSport
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 18 2014 19:44 GMT
#511
On July 19 2014 04:32 Aeromi wrote:
Is Avilo fulltime ?

Not quite, he coaches tennis part-time. But he streams every day for varying amounts of time.
Procrastination is the enemy
starslayer
Profile Joined August 2011
United States696 Posts
July 19 2014 06:19 GMT
#512
hey @ avilo check this qualifier http://msibeatit.com/tournaments/starcraft-2-american-qualifier-2/ also at http://www.teamliquid.net/forum/sc2-tournaments/461232-msi-beat-it-2014-american-qualifier-thread no body to hard to play doesnt seem that bad should check it out. it leads to another qualifier but it doesnt hurt to try it out more tourneys. i know i already posted it here but would be nice to see you in more stuff.
i came here to kickass and chew bubblegum and i'm all out of bubble gum
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 19 2014 06:30 GMT
#513
On July 19 2014 15:19 starslayer wrote:
hey @ avilo check this qualifier http://msibeatit.com/tournaments/starcraft-2-american-qualifier-2/ also at http://www.teamliquid.net/forum/sc2-tournaments/461232-msi-beat-it-2014-american-qualifier-thread no body to hard to play doesnt seem that bad should check it out. it leads to another qualifier but it doesnt hurt to try it out more tourneys. i know i already posted it here but would be nice to see you in more stuff.

Thanks man. I'll go nag him a bit and beat him with a club until he signs up. And then Arkansassy will do the same (he's a real huge procrastinator).
Procrastination is the enemy
Arkansassy
Profile Joined October 2010
358 Posts
Last Edited: 2014-07-22 02:58:27
July 19 2014 18:58 GMT
#514
Arkansassy will be too busy today checking out the WCS brackets to make sure that there aren't any players in the Wildcard qualifiers with under 200 wins last season.

Also, I still find it rather suspicious that avilo's rank from last season mysteriously disappeared from Bnet and that blizzard claims to have the number of wins, but refuses to send him proof. Granted he laddered mostly on his barcode account last season, but it's just all too convenient for my taste.

UPDATE: ThePharside explained to me in a PM how the system works, which I appreciated. So nothing suspicious there.

Also: The names that I and several others found that were under 200 wins, avilo checked out himself in the actual online bnet and said they did have 200 (exactly).

I'm sure avilo will make certain he has 200 wins for the next round.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 22 2014 21:08 GMT
#515
Just added a vod showing Avilo taking wild manic ferocious dumps all over a Protoss death ball with motherfucking mech!
Procrastination is the enemy
LordBishopX
Profile Joined July 2014
United States1 Post
July 24 2014 01:17 GMT
#516
Add me as the #1 FAN to the Brovillo fanpage. AVILO NATION YOUTUBE!!!!
AviloNATION
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 24 2014 01:35 GMT
#517
On July 24 2014 10:17 LordBishopX wrote:
Add me as the #1 FAN to the Brovillo fanpage. AVILO NATION YOUTUBE!!!!

Welcome to the club you sexy beast! <3
Procrastination is the enemy
FLORIDACOMPACT
Profile Joined May 2013
Germany108 Posts
July 28 2014 18:52 GMT
#518
mechin happen, add meee!

User was warned for this post
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 30 2014 00:58 GMT
#519
On July 29 2014 03:52 FLORIDACOMPACT wrote:
mechin happen, add meee!

Added <3
Procrastination is the enemy
MadMech_
Profile Joined July 2014
United States1 Post
July 30 2014 18:27 GMT
#520
Codonbyte PogChamp
"We need Bossterran" SwiftRage
Varroth
Profile Joined April 2014
Sweden471 Posts
July 30 2014 20:32 GMT
#521
Avilo is so annoying he loses he says ''that guy went full NA lol he allined me at 20 min with 4 bases and 200/200 with better upgrades and tech cause hes so bad guys'' or some other fking excuse and if you call him out on it you get banned for 600 seconds it's so fking sad just own up to the person being the better player when you lose it's not that damn hard and people might start liking you more if you fking do

User was warned for this post
Top10 favorite players: 1. Jaedong 2. Naniwa 3. Maru 4. ThorZaIN 5. Taeja 6. HerO 7. MC 8. Hyun 9. Soulkey 10. herO
Glorfindel!
Profile Joined May 2011
Sweden1815 Posts
Last Edited: 2014-07-30 21:38:54
July 30 2014 21:29 GMT
#522
What I have hard to understand is Avilos anger regarding Protoss turtling and getting great upgrades and a great army. He says he tries to attack, cant harass, and so on.
I wonder when he plays TvZ and goes full mech turtle if he can understand a Zerg player feeling the exactly same way?
Like, the Zerg tries to attack, do things and just faces a wall. Then loses in the long run?
http://eu.battle.net/sc2/en/profile/598681/1/Glorfindel/ladder/161337#current-rank
codonbyte
Profile Blog Joined June 2011
United States840 Posts
July 31 2014 00:54 GMT
#523
On July 31 2014 05:32 Varroth wrote:
Avilo is so annoying he loses he says ''that guy went full NA lol he allined me at 20 min with 4 bases and 200/200 with better upgrades and tech cause hes so bad guys'' or some other fking excuse and if you call him out on it you get banned for 600 seconds it's so fking sad just own up to the person being the better player when you lose it's not that damn hard and people might start liking you more if you fking do

Nice lies, dude. On Avilo's stream, we only time-out users who are outright rude and disrespectful. You're allowed to disagree as long as you do it respectfully. Based on the tone of your post, I highly doubt you even know how to disagree respectfully.
Procrastination is the enemy
00higgo
Profile Joined May 2013
Australia119 Posts
Last Edited: 2014-08-02 04:30:47
August 02 2014 04:22 GMT
#524
On July 31 2014 09:54 codonbyte wrote:
Show nested quote +
On July 31 2014 05:32 Varroth wrote:
Avilo is so annoying he loses he says ''that guy went full NA lol he allined me at 20 min with 4 bases and 200/200 with better upgrades and tech cause hes so bad guys'' or some other fking excuse and if you call him out on it you get banned for 600 seconds it's so fking sad just own up to the person being the better player when you lose it's not that damn hard and people might start liking you more if you fking do

Nice lies, dude. On Avilo's stream, we only time-out users who are outright rude and disrespectful. You're allowed to disagree as long as you do it respectfully. Based on the tone of your post, I highly doubt you even know how to disagree respectfully.
Actually whilst you may think you only ban disrespectful posts from what ive seen this is not the case.

The mods take everything so personally that you cant make a joke or try to refute anything avilo says.

The stream would be a lot more enjoyable except for the over the top moderation.

Sure you have to moderate the toxic stuff but the moderation of his channel is extremely severe.

Edit* This is just what i have observed when im in chat.
Arkansassy
Profile Joined October 2010
358 Posts
August 02 2014 19:52 GMT
#525
!rules
Be respectful of streamer, stream viewers and others. Do not discuss religion or politics. No personal or promotional links allowed. No porn. No racial slurs (slang terms). Failure to follow house rules can result in a timeout or ban.

Thems da house rules and apparently they are too difficult for some people to follow. We actually allow more freedom than a lot of chats; however, we will not tolerate people being ill-mannered. If they can't express their critique without name calling, (i.e. "no it wasn't fag." "are you retarded, idiot?" etc.) they're timed out. If you see that as "over the top" moderation, I'm sorry.

The only time a well-mannered critique is timed out is when it's already been addressed or explained by avilo or a mod and the person continues to go on and on after being warned.

My favorite warning is "00higgo, please stop " Viewers that are somewhat skilled in social graces usually take the hint.

When there are a lot of trolls/haters, warnings are sometimes impossible. Still we try our best to make chat fun for everyone.

00higgo
Profile Joined May 2013
Australia119 Posts
August 03 2014 04:45 GMT
#526
On August 03 2014 04:52 Arkansassy wrote:
!rules
Be respectful of streamer, stream viewers and others. Do not discuss religion or politics. No personal or promotional links allowed. No porn. No racial slurs (slang terms). Failure to follow house rules can result in a timeout or ban.

Thems da house rules and apparently they are too difficult for some people to follow. We actually allow more freedom than a lot of chats; however, we will not tolerate people being ill-mannered. If they can't express their critique without name calling, (i.e. "no it wasn't fag." "are you retarded, idiot?" etc.) they're timed out. If you see that as "over the top" moderation, I'm sorry.

The only time a well-mannered critique is timed out is when it's already been addressed or explained by avilo or a mod and the person continues to go on and on after being warned.

My favorite warning is "00higgo, please stop " Viewers that are somewhat skilled in social graces usually take the hint.

When there are a lot of trolls/haters, warnings are sometimes impossible. Still we try our best to make chat fun for everyone.


I understand that and i agree with it for the most part.

I know for me as a somewhat opinionated person that the moderation makes me feel its not worth chatting in there because im likely to get T/O'd for it.

For the most part i think you are a very good mod Sassy. But i am not inspired with faith by some of the others.
Luolis
Profile Blog Joined May 2012
Finland7165 Posts
August 03 2014 08:50 GMT
#527
I know one of my friends was banned after he asked if Avilo had seen Mvps mech games vs Snute when avilo was doing a rant on how aggressive mech is bad.
pro cheese woman / Its never Sunny in Finland. Perkele / FinnishStarcraftTrivia
Arkansassy
Profile Joined October 2010
358 Posts
August 04 2014 17:46 GMT
#528
Thanks for the compliment, 00higgo. We all do our best to make chat a pleasant experience for everyone.

As far as you being opinionated, I have a little story.

There is a viewer who frequents chat. He gets on my nerves with his opinions and his interference with the duties of the mods. He questions everything. Other viewers ask him why he's even watching the stream, because he never agrees with anything avilo says or anyone else for that matter. (I think he likes to argue for arguments sake).

I don't remember him ever being timed out, because despite the fact that he has his opinions contrary to avilo and others watching, he "almost" always presents well-mannered comments and whilst having his toes touching the line at times, he rarely crosses over.

Your opinions in chat, 00higgo, are well-received for the most part and I would hate to think that you're watching the stream without adding your views. Even if you do cross the line, it's only a short time out and during that time you can think of other things to which you disagree.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2014-08-05 04:32:18
August 05 2014 04:30 GMT
#529
00higgo, do you remember what was said that someone got TOd for that you think was out of line? btw, if you see a TO/ban that you disagree with in chat or think crosses the line, feel free to shoot one of us a PM. Should probably tell the mod you PMd in chat that you've PMd them in case they don't get the email from twitch.

But yeah, we're happy to discuss these things with you or listen to feedback. At times I've changed my course of action based on feedback from viewers, so it's definitely worth speaking up.

Oh and yes, Arkansassy is an AWESOME mod. By far the best mod I've seen in any twitch channel. She's incredibly fair; applies the rules consistently to everybody. Definitely the "mom" of Avilo's stream <3[platonic]
Procrastination is the enemy
Universum
Profile Joined January 2011
Canada192 Posts
August 12 2014 03:08 GMT
#530
Damn I need that replay from Avilo vs Penguin on Overgrowth on Red Bull Satellite from a few minutes ago. So awesome ! The protoss recalled on his nexus that was getting nuked and then 30 Hunter seeker missile sealed the deal. Pretty sick !
You often learn more from losing than winning. Don't rage, it's a game!
codonbyte
Profile Blog Joined June 2011
United States840 Posts
August 12 2014 17:14 GMT
#531
He said he will upload that replay. Hopefully he doesn't procrastinate too much :D
Procrastination is the enemy
Universum
Profile Joined January 2011
Canada192 Posts
August 13 2014 18:39 GMT
#532
Any good source for Avilo's recent replays ? Like a replay pack he would've released in the last two months ?
You often learn more from losing than winning. Don't rage, it's a game!
Insomniac313
Profile Joined August 2014
United States1 Post
August 17 2014 02:38 GMT
#533
Hey i would like to join the fan club, thank you.
Sleep is for the weak.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
August 17 2014 15:50 GMT
#534
On August 17 2014 11:38 Insomniac313 wrote:
Hey i would like to join the fan club, thank you.

Welcome to the club, Insomniac313! <3

On August 14 2014 03:39 Universum wrote:
Any good source for Avilo's recent replays ? Like a replay pack he would've released in the last two months ?

Avilo releases a replay pack of all his noteable games every 2 weeks to his subscribers. He also occasionally releases single replays that are especially noteworthy to everyone. An example would be that epic TvP he played where Protoss recalled into a nuke. He said he was going to upload that one. I'll go nag him to do that now #aviProcrastination.
Procrastination is the enemy
codonbyte
Profile Blog Joined June 2011
United States840 Posts
Last Edited: 2014-08-20 20:32:25
August 20 2014 20:31 GMT
#535
Avilo starting Bronze-Masters MECH tutorial NOW!! http://www.twitch.tv/avilo
Procrastination is the enemy
Predominance
Profile Joined August 2014
Italy5 Posts
August 24 2014 12:22 GMT
#536
Heya! ShagrathIT from twitch here, name's Predominance on SC2, add me plz :D
HallofPain
Profile Joined July 2014
Japan16 Posts
August 27 2014 15:43 GMT
#537
Count me in Bro!

I'm a silver league(soon to be bronze) Terran learning how to play this game. I got extremely slow hands and reaction time so Mech is the only possible way I can play. Watching Avilo stream definitely helps me alot.
GrundyKane
Profile Joined August 2014
United States3 Posts
August 28 2014 00:35 GMT
#538
I am number one fan
soup
codonbyte
Profile Blog Joined June 2011
United States840 Posts
August 28 2014 02:15 GMT
#539
Added all three of you, Predominance, HallofPain, and GrundyKane.

@GrundyKane: Should I also add GrundyKaneII, GrundyKaneIII, GrundyKaneIV...GrundyKaneXIII?
Procrastination is the enemy
GrundyKane
Profile Joined August 2014
United States3 Posts
August 28 2014 03:26 GMT
#540
Yes. I am up to XIV now
soup
codonbyte
Profile Blog Joined June 2011
United States840 Posts
September 01 2014 14:56 GMT
#541
On August 28 2014 12:26 GrundyKane wrote:
Yes. I am up to XIV now

Lol okay. And how many IPs have you gone through?
Procrastination is the enemy
dosnetwork
Profile Joined October 2009
United States2 Posts
September 05 2014 04:22 GMT
#542
Hey Avilo it is me CeLeRoN i would like to be added to the Fan Club.
Shefarin
Profile Joined September 2014
Greece1 Post
September 10 2014 22:35 GMT
#543
Add me plz
abendrot
Profile Joined July 2014
14 Posts
October 22 2014 11:55 GMT
#544
Yes Avilo gogogo I realy enjoy your strem! So funny and entertaining.
codonbyte
Profile Blog Joined June 2011
United States840 Posts
February 17 2015 06:31 GMT
#545
Attention Brovilos! After viewing some data that I collected for him about the usage of his subscriber-only emoticons in other channels, Avilo has decided to replace two of his emotes with new ones.

Awhile back, I collected chat logs of redbullesports, wcs_america and wcs_europe tournaments for several days and found that aviTank and aviThor were barely being used at all. As such, he has decided to replace them with two new emoticons:
[image loading][image loading]
They are aviSwag, and aviFtoss, respectively. aviSwag is the perfect emote to use when greeting people (aviSwag/), and Blizzard's incompetence at balancing the game all but guarantees that you will have many, many opportunities to use aviFtoss in SC2 tournament chats for years to come. Enjoy!
Procrastination is the enemy
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
March 15 2015 14:47 GMT
#546
i'll tolerate your semi-paranoid ranting about Terran being weak.... and other yelling, screaming and ranting..
1000X .. before i'll put up with a cheater and fraud.

thanks man..
for never cheating in any way.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
gDPhantom
Profile Joined January 2015
New Zealand162 Posts
April 07 2015 02:32 GMT
#547
So sad he got snobbed for LOTV, hope he gets wave 2
YNWA
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 07 2015 19:12 GMT
#548
On April 07 2015 11:32 gDPhantom wrote:
So sad he got snobbed for LOTV, hope he gets wave 2

He got in. Tim Morten came into his channel and worked it out at like 3am on beta launch day.
Procrastination is the enemy
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
April 07 2015 20:30 GMT
#549
Tim is an old C&C guy.
Avilo is an old C&C guy.

hmmmm forget about Lee Harvey Oswald and Big Foot... i think we have a conspiracy brewing here!
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 07 2015 20:37 GMT
#550
On April 08 2015 05:30 JimmyJRaynor wrote:
Tim is an old C&C guy.
Avilo is an old C&C guy.

hmmmm forget about Lee Harvey Oswald and Big Foot... i think we have a conspiracy brewing here!

Wow seriously? I did not know that Tim Morten was a C&C player. Maybe he's a secret Avilo fan! Hopefully that means LotV will be a good expansion for Avilo
Procrastination is the enemy
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
April 07 2015 20:42 GMT
#551
On April 08 2015 05:37 codonbyte wrote:
Show nested quote +
On April 08 2015 05:30 JimmyJRaynor wrote:
Tim is an old C&C guy.
Avilo is an old C&C guy.

hmmmm forget about Lee Harvey Oswald and Big Foot... i think we have a conspiracy brewing here!

Wow seriously? I did not know that Tim Morten was a C&C player. Maybe he's a secret Avilo fan! Hopefully that means LotV will be a good expansion for Avilo


Morten was a C&C Producer at EALA.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
Loccstana
Profile Blog Joined November 2012
United States833 Posts
Last Edited: 2015-04-12 04:13:22
April 11 2015 06:24 GMT
#552
Some pictures of avilo I found off the internet:
Moderator edit: Images have been removed
[url]http://i.imgur.com/lw2yN.jpg[/url]
avilo
Profile Blog Joined November 2007
United States4100 Posts
Last Edited: 2015-04-12 04:13:31
April 12 2015 02:49 GMT
#553
On April 11 2015 15:24 Loccstana wrote:
Some pictures of avilo I found off the internet:


Hey, can you not do that.
Sup
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 12 2015 04:25 GMT
#554
Thank you, whoever removed those images. That was fast!
Procrastination is the enemy
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 14 2015 23:33 GMT
#555
Avilo just won 2-1 vs snake in ro64 for WCS NA qualifiers! GG avilo, good job adapting to the new anti-mech maps! http://play.eslgaming.com/starcraft/global/sc2/major/wcs/2015-season-2-america-challenger-qualifier-2/rankings/
Procrastination is the enemy
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 15 2015 00:58 GMT
#556
Aaaand avilo goes 2-1 vs Wind, and advances to the Ro16! Good job avilo!
Procrastination is the enemy
Kevin_Sorbo
Profile Joined November 2011
Canada3217 Posts
April 15 2015 02:05 GMT
#557
great tvt in game 2 vs qxc

thank you for entertaining me with such an epic game bud


The mind is like a parachute, it doesnt work unless its open. - Zappa
starslayer
Profile Joined August 2011
United States696 Posts
April 15 2015 03:57 GMT
#558
Yea great games today! Really think if you work on the maps a bit more and build order choices you can really make it deep maybe even qualify. Hope you practice a bit more, maybe even off stream and go for the next couple qualifiers really think you came make it! Also try and keep a cool head in tourney games i understand talking about things like Swarmhost during ladder games but in tourneys you need to be focusing, and please don't take this the wrong way just want to help. Anyways GL next time.
i came here to kickass and chew bubblegum and i'm all out of bubble gum
codonbyte
Profile Blog Joined June 2011
United States840 Posts
April 17 2015 09:35 GMT
#559
On April 15 2015 12:57 starslayer wrote:
Yea great games today! Really think if you work on the maps a bit more and build order choices you can really make it deep maybe even qualify. Hope you practice a bit more, maybe even off stream and go for the next couple qualifiers really think you came make it! Also try and keep a cool head in tourney games i understand talking about things like Swarmhost during ladder games but in tourneys you need to be focusing, and please don't take this the wrong way just want to help. Anyways GL next time.

I think one of the issues that he's had lately is having his time divided between LotV and HotS. Obviously with the LotV beta out, he wants to be playing that so that he can remain up to speed with the latest news, and many of his viewers are going to be intrigued by this limited-access beta and will want to learn as much about it as possible. But then again there are still HotS tournaments going on, so he has to practice for those. His time gets divided, and tilt results.

Actually, I seem to recall him going on tilt back during the HotS beta first came out. The combination of the imbalances of WoL plus all the issues that came up during the beta seemed to put him on tilt for awhile, and I think we may be seeing something similar with the LotV beta.
Procrastination is the enemy
dr3am_b3ing
Profile Joined May 2015
Canada188 Posts
January 08 2016 16:44 GMT
#560
28 year old who resides with his mom and still has bunk beds nice

User was warned for this post
Potassium Gang
Tresher
Profile Joined October 2011
Germany404 Posts
Last Edited: 2016-01-08 18:15:03
January 08 2016 18:02 GMT
#561
^ Your Point?
While I don´t watch avilo anymore because he is sometimes exaggerating too much, hating on someone because of his real life situation is never a good thing to do. I know someone who is in a similar position and even been myself in a situation where I had to live quite long with my parents. Trust me this is not cool but sometimes you have to because life can be a huge asshole. I don´t think you have a slightest clue how hard it can be to get a job.
So please spare us with shit like this.
Extreme Force
Marl
Profile Joined January 2010
United States694 Posts
January 08 2016 18:53 GMT
#562
He may not be forumhugbox correct, but he loves the game, has been part of the community for a long time, and plays entertaining games. #avilo
Terr4one
Profile Joined January 2016
2 Posts
January 08 2016 21:31 GMT
#563
Sassy! Sassy! Where are you? Do you go to the chat now and hide? Have a different character? No longer a mod with pms and a gsp (oops I didn't get that exactly right) who will find you? Chat is no where near as smart or as fun as when you were holding the sword of truth.

All the best, Terr4one (I had a different handle and for some reason had to change it but this one is very close to identical) \0/
Terr4one
Profile Joined January 2016
2 Posts
January 08 2016 21:38 GMT
#564
What's the advantage of being "featured"? Avilo's stream is always listed on the T.L. website. Anyway the irony of an Avilo fan club is hilarious! Why? Because his persona is that of a wise ass trouble maker, which I personally love, not that of a hero with a fan club. Let us not forget the toxicity of his empire.

Does Spanishiwa play any more? His was a great stream too. (sigh).
GrandSmurf
Profile Joined July 2003
Netherlands462 Posts
January 09 2016 13:24 GMT
#565
im a believer. sign me up.
One time that happened and I just stopped everything, selected the offending SCV, hit Cancel, moved it over to my Barracks, made a Marine, had the Marine shoot it to death, then left the game.
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2016-02-26 18:22:16
February 26 2016 17:43 GMT
#566
Avilo is one of my favourite North American Master's League players. Its awesome watching him pwnerize the North American Master's League. His quest for #1 in his North American Master's League Division makes for compelling viewing.

Go Avilo Go! You'll make #1 by April 1!

On January 09 2016 03:02 Tresher wrote:
^ Your Point?
While I don´t watch avilo anymore because he is sometimes exaggerating too much, hating on someone because of his real life situation is never a good thing to do. I know someone who is in a similar position and even been myself in a situation where I had to live quite long with my parents. Trust me this is not cool but sometimes you have to because life can be a huge asshole. I don´t think you have a slightest clue how hard it can be to get a job.
So please spare us with shit like this.


r u sure he is even looking for a job? i thought he was a full time Starcraft2 coach and caster? that's his job i thought.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
ANGELIAS1234
Profile Joined September 2011
United States46 Posts
February 26 2016 19:49 GMT
#567
booooo

User was warned for this post
SPcrusader
Profile Joined September 2011
Norway99 Posts
February 27 2016 13:52 GMT
#568
I find Avilo entertaining. I consider myself a fan. And if you read this, Avilo. Know that there are people from far far away that truly appreciate what you do for the community. Thank you for being who you are.
https://www.twitch.tv/spcrusader
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
March 01 2016 18:51 GMT
#569
Congratz to Avilo and his promotion into the North American GM League!
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
MasterCynical
Profile Joined September 2012
505 Posts
March 02 2016 05:19 GMT
#570
I feel avilo to be entertaining like the days when we only had television and there were nothing but infomercials to watch during the day. they werent fun to watch in themselves, and completely trash compared to the good shows during night and afternoon, but it helped sate the boredom during the day when i was home sick or something.

Nowadays it feels like it's infomercials 80% of the time for sc2 streams.
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
March 02 2016 12:07 GMT
#571
i like that old infomercial with a product bald men can use to spray paint hair on their head.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
RichardNPL
Profile Joined November 2015
185 Posts
March 02 2016 13:41 GMT
#572
I like avilo keep up the good work! Don't listen to the haters! I enjoy your crazy long games
seemsgood
Profile Joined January 2016
5527 Posts
April 17 2016 00:27 GMT
#573
The thing like about players like ketroc ,happy,avilo is they don't scare in late game vs protoss.That why we can see the ultimate army of both side fight each other which almost never happen in other stream
He has a great late game vs protoss today.GJ! availo
RichardNPL
Profile Joined November 2015
185 Posts
April 24 2016 05:59 GMT
#574
keep up the casting I really enjoyed the games you casted in the wcs na qualifiers funny as hell!
Tresher
Profile Joined October 2011
Germany404 Posts
April 25 2016 04:18 GMT
#575
This guy has to stop claiming that he invented or innovated something that is just not true.WTF
Extreme Force
gtbex
Profile Joined March 2017
Poland39 Posts
March 25 2017 12:09 GMT
#576
Yesterday I saw a 2hour 41minutes ladder game from this awesome guy. You can hate or love him but no other stream entertains like this one does.

Pressure!
WeddingEpisode
Profile Blog Joined June 2011
United States356 Posts
May 01 2017 14:39 GMT
#577
When/where is Avilo going to post the list of his proposed LOTV changes?

Still diamond
Kevin_Sorbo
Profile Joined November 2011
Canada3217 Posts
May 08 2017 01:48 GMT
#578
On May 01 2017 23:39 WeddingEpisode wrote:
When/where is Avilo going to post the list of his proposed LOTV changes?



When is the tournament he is holding on that mod?
The mind is like a parachute, it doesnt work unless its open. - Zappa
Weavel
Profile Joined January 2010
Finland9223 Posts
May 08 2017 12:28 GMT
#579
On May 08 2017 10:48 Kevin_Sorbo wrote:
Show nested quote +
On May 01 2017 23:39 WeddingEpisode wrote:
When/where is Avilo going to post the list of his proposed LOTV changes?



When is the tournament he is holding on that mod?
He said that it didn't happen last week because it would conflict with that other tournament. Maybe this week(end)?
Life/Seed//Mvp/NaNiwa fighting! ZeNEX forever!
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
July 01 2017 22:02 GMT
#580
nice 40 minute win today. it was fun.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
MKStyles
Profile Joined April 2017
106 Posts
August 02 2017 12:10 GMT
#581
Banned
Loccstana
Profile Blog Joined November 2012
United States833 Posts
August 02 2017 23:00 GMT
#582
Avilo, we feel for you ;_;
[url]http://i.imgur.com/lw2yN.jpg[/url]
getg00d
Profile Joined April 2017
United States120 Posts
August 03 2017 04:15 GMT
#583
<3
https://www.twitch.tv/getg00d
Alejandrisha
Profile Blog Joined July 2010
United States6565 Posts
August 08 2017 23:08 GMT
#584
listened to him talk to destiny for a few hours. hope he gets help. conflicted because of all the shit he has thrown at me and my bois but humanity transcends the game.
get rich or die mining
TL+ Member
DieuCure
Profile Joined January 2017
France3713 Posts
October 10 2017 20:39 GMT
#585
I'm not a fan but for God's sake it's pretty sad what happens to Avilo because of this story ...
TL+ Member
Embir
Profile Joined January 2011
Poland567 Posts
October 16 2017 11:39 GMT
#586
Well, I watch his stream mainly for the lulz and hilarious trolls but man, it is proper meltdown.
Uberfather
Profile Joined June 2017
272 Posts
October 16 2017 18:01 GMT
#587
What happened?
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2017-10-16 21:28:07
October 16 2017 21:25 GMT
#588
i thought this whole getting cat-fished by a fake gf who Avilo sends money to every week had blown over. i thought Avilo finally figured it out... and then i saw this yesterday...



sometimes truth is stranger than fiction.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
Loccstana
Profile Blog Joined November 2012
United States833 Posts
November 26 2017 02:14 GMT
#589
uh oh here we go again...
[url]http://i.imgur.com/lw2yN.jpg[/url]
Kaewins
Profile Joined April 2013
Bulgaria138 Posts
November 26 2017 13:50 GMT
#590
I worry I will wake up some day and find out he shot up a bunch of people in real life.

It's like we all watch this person sink deeper into his own delusions and getting angrier, and angrier because some girl he never met doesn't want to be his online girlfriend anymore.

He's not letting this go for months and it's obvious this isn't going to end in a healthy manner.

Poor girl must be scared out of her mind right now, I know I would be.
MKStyles
Profile Joined April 2017
106 Posts
November 26 2017 15:10 GMT
#591
On November 26 2017 22:50 Kaewins wrote:
I worry I will wake up some day and find out he shot up a bunch of people in real life.

It's like we all watch this person sink deeper into his own delusions and getting angrier, and angrier because some girl he never met doesn't want to be his online girlfriend anymore.

He's not letting this go for months and it's obvious this isn't going to end in a healthy manner.

Poor girl must be scared out of her mind right now, I know I would be.


But its his gf and she cheated on him =( , Kappa

User was temp banned for this post.
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2017-11-26 16:08:24
November 26 2017 16:07 GMT
#592
i wonder how much cash he sent her for being a "stellar employee" and the "best MOD".
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
RoflStomped
Profile Joined July 2017
Iceland21 Posts
November 26 2017 18:46 GMT
#593
I don't think it really matters anymore. She's a liar and he's obsessed, they both need to move the **** on.
bretfart
Profile Joined July 2012
114 Posts
December 19 2017 05:44 GMT
#594
he's been offline for a couple of days. He is either in Italy right now getting arrested or grounded for his screaming shouting and swearing
AlgeriaT
Profile Joined April 2010
Sweden2197 Posts
March 08 2018 10:50 GMT
#595
Avilo to Nationwars 3!

All you need to do is follow the link below, select Avilo and hit the vote button. You don't need to go through all the other countries or anything. Easy as pie.

And remember YOU CAN VOTE ONCE PER DAY!

We're just behind third place at the moment (top 3 votes go to the tourney) so your votes are needed. Come on guys, let's MECH IT HAPPEN!!!

http://nationwars.tv/vote
CORN GIRL + Flash + FanTaSy + CholeraSC + iNcontroL 4 eva <3
AlgeriaT
Profile Joined April 2010
Sweden2197 Posts
March 09 2018 16:13 GMT
#596
Let's go guys, one vote per day allowed! And we're so close!! Have you done what you could to help our MECH SAVIOR today??

http://nationwars.tv/vote
CORN GIRL + Flash + FanTaSy + CholeraSC + iNcontroL 4 eva <3
RaccyG
Profile Joined May 2017
14 Posts
March 14 2018 20:21 GMT
#597
How it should be:

[image loading]

Praise avilo!! Nationwars HYPE!
AlgeriaT
Profile Joined April 2010
Sweden2197 Posts
April 05 2018 11:57 GMT
#598
Guys the time has finally come! Avilo Nation vs The Netherlands in three hours!! ARE YOU READY TO MECH IT HAPPEN???

http://liquipedia.net/starcraft2/StarCraft_II:_NationWars_V
CORN GIRL + Flash + FanTaSy + CholeraSC + iNcontroL 4 eva <3
Weavel
Profile Joined January 2010
Finland9223 Posts
April 05 2018 15:13 GMT
#599
Good luck Avilo!
Life/Seed//Mvp/NaNiwa fighting! ZeNEX forever!
bretfart
Profile Joined July 2012
114 Posts
April 06 2018 06:41 GMT
#600
On April 05 2018 20:57 AlgeriaT wrote:
Guys the time has finally come! Avilo Nation vs The Netherlands in three hours!! ARE YOU READY TO MECH IT HAPPEN???

http://liquipedia.net/starcraft2/StarCraft_II:_NationWars_V


everybody who seriously thought avilo would have the slightest chance against 6kmmr+ guys has no idea about starcraft
Balosaar
Profile Joined August 2012
United States35 Posts
December 23 2018 16:34 GMT
#601
Looks like Avilo got a perma ban on this site.

Reason: I think it is time for us to part ways at this point. You are never going to stop balance whining anyway.


Love or hate Avilo, this just comes off sounding like some personal power trip. Avilo may be delusional and wrong, and his opinions on balance may be in the minority, but deplatforming him because he thinks swarmhosts and tempests are busted, I am not sure that's a reasonable excuse.

If he broke actual rules, and this was in response to that, then fine... but that's not what this looks like had happened.

2014 WCS Champion StarTale Life ... Best Zerg of Heart of the Swarm
yhellothere12
Profile Joined November 2016
46 Posts
December 23 2018 20:05 GMT
#602
On December 24 2018 01:34 Balosaar wrote:
Looks like Avilo got a perma ban on this site.

Show nested quote +
Reason: I think it is time for us to part ways at this point. You are never going to stop balance whining anyway.


Love or hate Avilo, this just comes off sounding like some personal power trip. Avilo may be delusional and wrong, and his opinions on balance may be in the minority, but deplatforming him because he thinks swarmhosts and tempests are busted, I am not sure that's a reasonable excuse.

If he broke actual rules, and this was in response to that, then fine... but that's not what this looks like had happened.




The reason given was embarrassing. Pretty childish and IMO definitely a personal power trip.

StiMpacKeD1
Profile Joined December 2018
5 Posts
Last Edited: 2018-12-23 21:48:50
December 23 2018 21:45 GMT
#603
Avilo deserves to be unbanned. Banning him for pointing out imbalance is shameful, regardless of how you feel towards him. He has a target on his head for being vocal about imbalance and those who still suckle from the teat of Blizzard refuse to acknowledge it.


Blizzard can't fix the game or remove units because they are sellouts to the microtransaction(skins). Removal of an imbalanced unit creates a new problem with the end user that was foolish enough to make the microtransaction.
Xain0n
Profile Joined November 2018
Italy3963 Posts
December 23 2018 22:49 GMT
#604
To be honest you are depicting Avilo as a martyr which he clearly is not.
He points out perceived imbalances in a quite arrogant way, addressing those(the majority) who don't agree with him in a disregarding manner.

Thus said, I personally don't think he deserved a permaban for that post.
dummy1
Profile Blog Joined April 2018
420 Posts
December 24 2018 00:13 GMT
#605
Wrong decision.
https://www.youtube.com/c/DepressingStarcraft <- Maru VODs and stuff | END REGION-LOCK NOW
Marl
Profile Joined January 2010
United States694 Posts
December 24 2018 05:36 GMT
#606
starcraft 2 doomed avilo and teamliquid. luckily broodwar came back.
Ej_
Profile Blog Joined January 2013
47656 Posts
December 24 2018 07:34 GMT
#607
On December 24 2018 07:49 Xain0n wrote:
To be honest you are depicting Avilo as a martyr which he clearly is not.
He points out perceived imbalances in a quite arrogant way, addressing those(the majority) who don't agree with him in a disregarding manner.

Thus said, I personally don't think he deserved a permaban for that post.

It wasnt his 1st time doing that, or his 50th. He didnt make a single meaningful contribution on the site in ages(maybe ever) TL.net to him was just another platform to preach his skewed view of the game.
I don't see a reason why the permaban wasn't deserved.
"Technically the dictionary has zero authority on the meaning or words" - Rodya
Jealous
Profile Blog Joined December 2011
10313 Posts
December 24 2018 17:31 GMT
#608
On December 24 2018 16:34 Ej_ wrote:
I don't see a reason why the permaban wasn't deserved.

Because you're in an avilo fanclub thread, that's why there is no reason to ban avilo.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
blunderfulguy
Profile Blog Joined April 2016
United States1415 Posts
December 24 2018 23:47 GMT
#609
(Quick post on mobile, apologies for any typos and whatnot.)

There comes a point when you realize some people will never change, no matter much you offer them or how time passes. It seems the TL folks came to that point, which most people here seemed to reach a long time ago.

The few times he didn't act angry, wasn't demeaning to people who didn't see or think the same way as him, wasn't attacking others, wasn't bashing the developers and/or players for one reason (I use the term "reason" loosely as many of his posts were fuled purely by emotion) or another, wasn't trying to push his selfish agenda on everyone around him, and so on, the few times when actually engaged in a real discussion, were entirely buried seven feet deep beneath the rest of his actions.

I reached out to him a few times when I was genuinely worried about him based on his repeated and worsening behavior on the site and on Twitch, and, the couple of times he did respond, he either responded as if I was intending to humiliate him or responded as if I were a piece of garbage stuck to his shoe and was offended that I was making noise. I don't like having toxic people in our community, I don't believe anyone should, and it's a shame that his fans are (apprently) incapable of looking at him and the current situation realistically. He is predominantly angry, selfish, hateful, toxic, on TL and in tournaments and on Twitch, and while he's shown other much more positive sides of himself here and there (I'm thinking specifically of an offline tournament earlier this year but can't recall which one it was), it's a shame he hasn't been able to learn, to change, and at least be better on sites that he (apparently) cares a lot about being able to use and to use them to start more discussions and seriously, positively engage with people.

It might come as a surprise to people, but I care a lot about Avilo. I hate seeing people behave the way he does, but for a long time I strongly felt that he rise far above his own flaws and become a widely respectable member of the community. It's sad that he's shut down that possibility so many times and, this time, it seems, for good here. It's also sad to me because it was entirely expected. Having an outspoken person with a platform and audience who engaged on forums would normally be missed, but it would be insincere to say many people will miss the person in this instance.
Blunder Man doing everything thing a blunder can.
igay
Profile Blog Joined November 2011
Australia1178 Posts
December 25 2018 01:31 GMT
#610
Bring Avi back! <3
MVP <3 MKP <3 DRG <3
yhellothere12
Profile Joined November 2016
46 Posts
December 25 2018 01:38 GMT
#611
On December 25 2018 02:31 Jealous wrote:
Show nested quote +
On December 24 2018 16:34 Ej_ wrote:
I don't see a reason why the permaban wasn't deserved.

Because you're in an avilo fanclub thread, that's why there is no reason to ban avilo.





I don't think everyone who is posting about this issue is an avilo fan; this is just really the only available medium to discuss since other topics mentioning avilo will be closed immediately.

Just because someone may think that the ban is stupid doesn't automatically mean they're an avilo fan. I've called out his BS on a number of occasions, including on Twitch. However, that doesn't mean that I'm going to do ad hominem attacks and not disagree when Avilo gets wronged. One has to try his/her hardest to be impartial and look at the situation as objectively and possible.


Also in regards to the balance whining, this is just laughable. Have you seen any balance discussion topic across Teamliquid, reddit, bnet forums, twitch, etc...? It's full of people disagreeing with each other on whether one race is imbalanced or not, and it's usually done in a highly condescending manner. Also to give credit where credit is due, Avilo did advocate for Terran units being nerfed numerous times in the past (reapers and ravens), which did end up happening. It's not like it's always just whining P and Z.
Ve5pa
Profile Joined December 2014
United Kingdom252 Posts
December 25 2018 02:47 GMT
#612
TL.net always seemed to be pretty fair to Avilo in the past. I'm not really sure what has changed? Yes he is pretty polarising in his opinions on the game but as a Terran fan who enjoys mech he was someone who I enjoyed to watch. Yes, it was his choice to play off meta for years even when it clearly wasn't the best option. He has moaned and whined about balance for as long as time, but TL.net never seemed to have a problem with it. Was their a flash-point in which he went over the top or something?
Perhaps not all but at least some of the stuff about him calling people out for being hackers seems genuine and that does seem to be more prevalent on this last patch.

I hope both parties can sort this out!
-Kyo-
Profile Blog Joined August 2010
Japan1926 Posts
Last Edited: 2018-12-25 15:08:55
December 25 2018 15:04 GMT
#613
I would say I'm surprised at many of the emotional responses here, but then again... not really...

For people to think this is one crazy mod banning such an 'influencer' in the scene for no reason other than 'power tripping' must have no idea how structured/ many secret forums TL is/has.

My first instinct was that this was discussed previously, constantly brought up, and slowly moved towards with each infraction Avilo made among a collective number of moderators in private. Eventually they had enough reason to do so, but probably decided not to for the otherwise good benefits Avilo had on the site/scene just #s wise.

However, he probably just ended up being too toxic, and his constant posts that showed no turning point towards actual either meaningful discussion/objective assessment of the game/all the other problems led to this decision.

Well, that's what I thought, so I checked Avilo's stream to check if there was anything else that might have happened and literally in his last stream the first hour is spent about him saying stuff that was sent in PMs... the main points being:
1) this was not a mistake, and it's final.
2) this wasn't one person, it was a group of people who decided, and issued by an individual.
3) that individual has the rights to the unbanning, but as it was done by a collective number of mods, the chance of that changing are, as mentioned in point one, quite low.

So pretty much what I thought from the start. TL isn't the sort of system where people do whatever they want with their mod powers. These are people of the community who have given to the site for a prolonged period of time, or who are actually hired employees. Avilo confirmed as much.

If he wants to be unbanned, I'd imagine he'd need to take steps towards showing he actually cared rather than doubling down. It's not beyond the mods at TL to understand that people change and ought to be hosted with a change of attitude. It's happened numerous times with the sidebar listing.

For the record, saying " don't sink down to the level of this fucking power tripping piece of shit, don't sink down to that level " in reference to KadaverBB is probably not a good start.
+
Anime is cuter than you. Legacy of the Void GM Protoss Gameplay: twitch.tv/kyo7763 youtube.com/user/KyoStarcraft/
TL+ Member
Hadronsbecrazy
Profile Joined September 2013
United Kingdom551 Posts
December 25 2018 21:20 GMT
#614
avilo omegalul
No need Build Orders, Only Micro,Favourite Players: Maru, Zest, soOjwa , CJherO
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2018-12-25 21:30:33
December 25 2018 21:24 GMT
#615
These Red Alert 3 games are a lot more fun than watching Avilo sit in his Terran base macro-ing all day long. That Soviet Navy is too sweet.



for the record.. that is a Terror Drone.. .not a WarBear ... that kills the Ninja.

This is why RTS games are so much damn fun.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
[F_]aths
Profile Blog Joined February 2010
Germany3947 Posts
Last Edited: 2018-12-26 13:20:49
December 26 2018 13:03 GMT
#616
On December 25 2018 11:47 Ve5pa wrote:
TL.net always seemed to be pretty fair to Avilo in the past. I'm not really sure what has changed? Yes he is pretty polarising in his opinions on the game but as a Terran fan who enjoys mech he was someone who I enjoyed to watch. Yes, it was his choice to play off meta for years even when it clearly wasn't the best option. He has moaned and whined about balance for as long as time, but TL.net never seemed to have a problem with it. Was their a flash-point in which he went over the top or something?
Perhaps not all but at least some of the stuff about him calling people out for being hackers seems genuine and that does seem to be more prevalent on this last patch.

I hope both parties can sort this out!

As someone having moderator responsibilities in other forums (not on TL) I consider TL being quite forgiving when it comes to community figures. And with good reasons, as those keep a portion of the fans in that forum. (And an esports focused forum gets more credibility if players are present.)

On the other hand, a well-moderated forum provides a player with a credible platform. Avilo's posting which yielded the ban has to be viewed in the history of past postings.

I personally don't like how "old boys" treat players like Avilo (though I also don't see him accepting mentorship from experienced players) but from a general moderation standpoint, TL's decision is anything but a powertrip.
You don't choose to play zerg. The zerg choose you.
Jealous
Profile Blog Joined December 2011
10313 Posts
Last Edited: 2018-12-26 17:55:59
December 26 2018 17:54 GMT
#617
On December 26 2018 22:03 [F_]aths wrote:
Show nested quote +
On December 25 2018 11:47 Ve5pa wrote:
TL.net always seemed to be pretty fair to Avilo in the past. I'm not really sure what has changed? Yes he is pretty polarising in his opinions on the game but as a Terran fan who enjoys mech he was someone who I enjoyed to watch. Yes, it was his choice to play off meta for years even when it clearly wasn't the best option. He has moaned and whined about balance for as long as time, but TL.net never seemed to have a problem with it. Was their a flash-point in which he went over the top or something?
Perhaps not all but at least some of the stuff about him calling people out for being hackers seems genuine and that does seem to be more prevalent on this last patch.

I hope both parties can sort this out!

As someone having moderator responsibilities in other forums (not on TL) I consider TL being quite forgiving when it comes to community figures. And with good reasons, as those keep a portion of the fans in that forum. (And an esports focused forum gets more credibility if players are present.)

On the other hand, a well-moderated forum provides a player with a credible platform. Avilo's posting which yielded the ban has to be viewed in the history of past postings.

I personally don't like how "old boys" treat players like Avilo (though I also don't see him accepting mentorship from experienced players) but from a general moderation standpoint, TL's decision is anything but a powertrip.

Avilo has been around since Brood War and has only gotten worse. Over 10 years of avilo. Think about it.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
December 26 2018 20:57 GMT
#618
Avilo is spending a lot of time playing Red Alert 3 while being listed as a Terran SC2 player in the sidebar. Is that within the rules?
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
KadaverBB
Profile Blog Joined June 2009
Germany25658 Posts
December 26 2018 21:11 GMT
#619
Technically no, but it happens to a lot of other streamers as well that forget to switch to the correct game on twitch. It's not a big deal.
AdministratorLaws change depending on who's making them, but justice is justice
Balosaar
Profile Joined August 2012
United States35 Posts
December 27 2018 05:14 GMT
#620
Speaking of rules, which one did avilo break to get permanently banned?
2014 WCS Champion StarTale Life ... Best Zerg of Heart of the Swarm
dummy1
Profile Blog Joined April 2018
420 Posts
December 27 2018 05:18 GMT
#621
Laws change depending on who's making them
https://www.youtube.com/c/DepressingStarcraft <- Maru VODs and stuff | END REGION-LOCK NOW
THEaviNATION
Profile Joined December 2018
1 Post
December 27 2018 05:35 GMT
#622
TL mods are fucking Nazis man avilo is the hero we need but not the hero we deserve avilo single handedly saved our beloved videogame from EXTINCTION man avilo deserves us and we deserve him rest in peace man never stop avilo never stop TL mods please do the right thing and unban the dude he never did any wrong he never break rules man please give the dude the respect of a champion if werent for avilo STARCRAFT would be DEAD man he aint gonna bite ya if he is unbanned man avilo forever respect dude man

User was banned for this post.
Gurbak
Profile Joined January 2017
France622 Posts
December 27 2018 06:51 GMT
#623
On December 27 2018 14:14 Balosaar wrote:
Speaking of rules, which one did avilo break to get permanently banned?

all of them
SC-Shield
Profile Joined December 2018
Bulgaria842 Posts
Last Edited: 2018-12-27 08:50:27
December 27 2018 08:47 GMT
#624
On December 27 2018 14:14 Balosaar wrote:
Speaking of rules, which one did avilo break to get permanently banned?


Talking about imbalances gets normal users warned or banned quite often. If you're an old user, especially with a lot of posts, the chance that you get away with that behaviour is higher. If you're a community figure (caster, pro gamer or streamer), then the chance is even higher. However, that doesn't mean such people are immune to bans. IdrA got banned in the past for toxic behaviour mostly and much less for balance whining. This is my observation of TL during several years.
If you're asking why permanently, then I guess he got warned/banned in the past temporarily, but he didn't change his behaviour very much. Some moderator/admin guy said earlier that they were ignoring his behaviour for some time.
Loccstana
Profile Blog Joined November 2012
United States833 Posts
December 27 2018 08:55 GMT
#625
Avilo is banned but he is still listed on TL as a featured streamer. Mixed messages here?
[url]http://i.imgur.com/lw2yN.jpg[/url]
getg00d
Profile Joined April 2017
United States120 Posts
December 27 2018 09:20 GMT
#626
On December 27 2018 17:55 Loccstana wrote:
Avilo is banned but he is still listed on TL as a featured streamer. Mixed messages here?

I don't think so. Teamliquid seems to value him as a streamer in the SC community, just not as a member in the SC Forum community.
https://www.twitch.tv/getg00d
StiMpacKeD1
Profile Joined December 2018
5 Posts
Last Edited: 2018-12-28 02:01:40
December 28 2018 02:01 GMT
#627
"In a time of universal deceit, telling the truth is a revolutionary act."

Blizzard wants SC2 to wander out into the pasture and die. After witnessing their business moves with putting microtransactions above all else, and killing off their trademark franchise titles(diablo, heroes, SC), it is no surprise folks like Avilo are being silenced for speaking up.


Don't you guys own a cell phone? Jeez.
JimmiC
Profile Blog Joined May 2011
Canada22817 Posts
December 28 2018 02:57 GMT
#628
--- Nuked ---
Falling
Profile Blog Joined June 2009
Canada11496 Posts
December 28 2018 04:44 GMT
#629
On December 28 2018 11:01 StiMpacKeD1 wrote:
"In a time of universal deceit, telling the truth is a revolutionary act."

Blizzard wants SC2 to wander out into the pasture and die. After witnessing their business moves with putting microtransactions above all else, and killing off their trademark franchise titles(diablo, heroes, SC), it is no surprise folks like Avilo are being silenced for speaking up.


Don't you guys own a cell phone? Jeez.

...You do realize Blizzard and TL are separate entities, don't you?
Moderator"In Trump We Trust," says the Golden Goat of Mar a Lago. Have faith and believe! Trump moves in mysterious ways. Like the wind he blows where he pleases...
FFW_Rude
Profile Blog Joined November 2010
France10201 Posts
December 28 2018 14:36 GMT
#630
He's banned ? No reason to read community updates past the OP anymore
#1 KT Rolster fanboy. KT BEST KT ! Hail to KT playoffs Zergs ! Unofficial french translator for SlayerS_`Boxer` biography "Crazy as me".
Carminedust
Profile Joined October 2014
487 Posts
December 29 2018 05:45 GMT
#631
On December 28 2018 23:36 FFW_Rude wrote:
He's banned ? No reason to read community updates past the OP anymore



i have found another person that feels the same way as i do xD
Maybe was Zoun only Fan before he retired idk
WaesumNinja
Profile Joined February 2012
210 Posts
Last Edited: 2018-12-29 11:43:24
December 29 2018 11:34 GMT
#632
On December 29 2018 14:45 Carminedust wrote:
Show nested quote +
On December 28 2018 23:36 FFW_Rude wrote:
He's banned ? No reason to read community updates past the OP anymore

i have found another person that feels the same way as i do xD


Oh don't kid yourself, you already know what he'd say anyway.

Avilo certainly had some kind of ban coming, and if it wasn't for his constant balance complaints that would've gotten anyone banned then it might as well have been the baseless cheater accusations that'd drive in the final nail.

I enjoy watching his stream and I think he's a good, though unnecessarily stubborn player. He's probably right about a lot of things he says but he certainly could make his points much better than endless ramblings while frustrated on stream or on the forums.

I'm sure he could compile a comprehensive video on his thoughts on the current balance, using clips of professional gameplay, from assorted streams and unit tester footage. I think he has done similar things in the past but lately it's just been winding posts in patch threads, or re-making an old thread to say the same things. It's just venting frustration as well as fuelling others fires rather than inviting for constructive discussion that the actual balance team could've taken into consideration.

Better yet, he has a sufficiently influential position to create a balancepatch map that people would've tried out. Sure, it would preach to his choir, and some who'd try would play a few games on it as some kind of joke to them. Either way it'd share his ideas much more effectively, especially if he took it seriously and balanced it fairly. I don't know if you're reading this Avilo, but you have more tools than most on this forum to express your ideas, don't throw them away. Anything you share on your stream can still be posted here by many of your viewers.
Loccstana
Profile Blog Joined November 2012
United States833 Posts
December 29 2018 23:16 GMT
#633
Someone please organize a BO31 showmatch between Serral and Avilo, with the prize for winning being unbanned from the TL forums.
[url]http://i.imgur.com/lw2yN.jpg[/url]
Kevin_Sorbo
Profile Joined November 2011
Canada3217 Posts
December 30 2018 00:52 GMT
#634
Serral would probably dodge. Don't forget he stole avilo's builds to win Blizzcon.

I wonder what amazes me the most, the fact that some people see avilo as a victim or that he managed to avoid getting banned all those years.

The mind is like a parachute, it doesnt work unless its open. - Zappa
Jealous
Profile Blog Joined December 2011
10313 Posts
December 30 2018 02:27 GMT
#635
On December 29 2018 20:34 WaesumNinja wrote:
Show nested quote +
On December 29 2018 14:45 Carminedust wrote:
On December 28 2018 23:36 FFW_Rude wrote:
He's banned ? No reason to read community updates past the OP anymore

i have found another person that feels the same way as i do xD


Oh don't kid yourself, you already know what he'd say anyway.

Avilo certainly had some kind of ban coming, and if it wasn't for his constant balance complaints that would've gotten anyone banned then it might as well have been the baseless cheater accusations that'd drive in the final nail.

I enjoy watching his stream and I think he's a good, though unnecessarily stubborn player. He's probably right about a lot of things he says but he certainly could make his points much better than endless ramblings while frustrated on stream or on the forums.

I'm sure he could compile a comprehensive video on his thoughts on the current balance, using clips of professional gameplay, from assorted streams and unit tester footage. I think he has done similar things in the past but lately it's just been winding posts in patch threads, or re-making an old thread to say the same things. It's just venting frustration as well as fuelling others fires rather than inviting for constructive discussion that the actual balance team could've taken into consideration.

Better yet, he has a sufficiently influential position to create a balancepatch map that people would've tried out. Sure, it would preach to his choir, and some who'd try would play a few games on it as some kind of joke to them. Either way it'd share his ideas much more effectively, especially if he took it seriously and balanced it fairly. I don't know if you're reading this Avilo, but you have more tools than most on this forum to express your ideas, don't throw them away. Anything you share on your stream can still be posted here by many of your viewers.

Pretty sure he had a balance patch test thing at some point to be fair.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
WaesumNinja
Profile Joined February 2012
210 Posts
December 30 2018 02:30 GMT
#636
On December 30 2018 11:27 Jealous wrote:
Show nested quote +
On December 29 2018 20:34 WaesumNinja wrote:
On December 29 2018 14:45 Carminedust wrote:
On December 28 2018 23:36 FFW_Rude wrote:
He's banned ? No reason to read community updates past the OP anymore

i have found another person that feels the same way as i do xD


Oh don't kid yourself, you already know what he'd say anyway.

Avilo certainly had some kind of ban coming, and if it wasn't for his constant balance complaints that would've gotten anyone banned then it might as well have been the baseless cheater accusations that'd drive in the final nail.

I enjoy watching his stream and I think he's a good, though unnecessarily stubborn player. He's probably right about a lot of things he says but he certainly could make his points much better than endless ramblings while frustrated on stream or on the forums.

I'm sure he could compile a comprehensive video on his thoughts on the current balance, using clips of professional gameplay, from assorted streams and unit tester footage. I think he has done similar things in the past but lately it's just been winding posts in patch threads, or re-making an old thread to say the same things. It's just venting frustration as well as fuelling others fires rather than inviting for constructive discussion that the actual balance team could've taken into consideration.

Better yet, he has a sufficiently influential position to create a balancepatch map that people would've tried out. Sure, it would preach to his choir, and some who'd try would play a few games on it as some kind of joke to them. Either way it'd share his ideas much more effectively, especially if he took it seriously and balanced it fairly. I don't know if you're reading this Avilo, but you have more tools than most on this forum to express your ideas, don't throw them away. Anything you share on your stream can still be posted here by many of your viewers.

Pretty sure he had a balance patch test thing at some point to be fair.


I have some faint memories of this also. What happened with it? When was it?
Jealous
Profile Blog Joined December 2011
10313 Posts
December 30 2018 02:33 GMT
#637
On December 30 2018 11:30 WaesumNinja wrote:
Show nested quote +
On December 30 2018 11:27 Jealous wrote:
On December 29 2018 20:34 WaesumNinja wrote:
On December 29 2018 14:45 Carminedust wrote:
On December 28 2018 23:36 FFW_Rude wrote:
He's banned ? No reason to read community updates past the OP anymore

i have found another person that feels the same way as i do xD


Oh don't kid yourself, you already know what he'd say anyway.

Avilo certainly had some kind of ban coming, and if it wasn't for his constant balance complaints that would've gotten anyone banned then it might as well have been the baseless cheater accusations that'd drive in the final nail.

I enjoy watching his stream and I think he's a good, though unnecessarily stubborn player. He's probably right about a lot of things he says but he certainly could make his points much better than endless ramblings while frustrated on stream or on the forums.

I'm sure he could compile a comprehensive video on his thoughts on the current balance, using clips of professional gameplay, from assorted streams and unit tester footage. I think he has done similar things in the past but lately it's just been winding posts in patch threads, or re-making an old thread to say the same things. It's just venting frustration as well as fuelling others fires rather than inviting for constructive discussion that the actual balance team could've taken into consideration.

Better yet, he has a sufficiently influential position to create a balancepatch map that people would've tried out. Sure, it would preach to his choir, and some who'd try would play a few games on it as some kind of joke to them. Either way it'd share his ideas much more effectively, especially if he took it seriously and balanced it fairly. I don't know if you're reading this Avilo, but you have more tools than most on this forum to express your ideas, don't throw them away. Anything you share on your stream can still be posted here by many of your viewers.

Pretty sure he had a balance patch test thing at some point to be fair.


I have some faint memories of this also. What happened with it? When was it?

I'm on mobile so my best suggestion would be for you to use the search function. Leave the text box blank, leave the option selected for "threads only," type in avilo into the username filter, should be in there and easy to find.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
FrkFrJss
Profile Joined April 2015
Canada1205 Posts
December 30 2018 11:06 GMT
#638
You probably found already, but for anyone who's wondering, here it is:

https://www.teamliquid.net/forum/sc2-tournaments/523124-avilo-balance-mod-tournament-800-prize-pool

It had....a less than stellar reception by a lot of people.
"Keep Moving Forward" - Walt Disney
MockHamill
Profile Joined March 2010
Sweden1798 Posts
December 30 2018 12:33 GMT
#639
I do not think the ban matter much.

There is almost no strategic discussion here, just copy what the pros do or be silent.

TL has stopped being the place for SC2 discussion a long time ago. Everyone has moved to reddit or bnet, here anything that slightly controversial will result in a locked thread.
Kevin_Sorbo
Profile Joined November 2011
Canada3217 Posts
December 30 2018 13:29 GMT
#640
On December 30 2018 20:06 FrkFrJss wrote:
You probably found already, but for anyone who's wondering, here it is:

https://www.teamliquid.net/forum/sc2-tournaments/523124-avilo-balance-mod-tournament-800-prize-pool

It had....a less than stellar reception by a lot of people.


Avilo held an 800$ tournament after he raised 3k+ out of a 3500$ goal to go to DH Austin in 2017. He raised funds to travel to the event with his gf of the time but in the end 3k+ was not enough for a weekend in Austin so he pulled the plug on the project. You can understand why the 800$ tournament was not well received.

The mind is like a parachute, it doesnt work unless its open. - Zappa
JudeauTV
Profile Joined August 2011
Germany262 Posts
December 30 2018 13:43 GMT
#641
Don't forget that only $500 of the $800 prize pool were from avilo. the other $300 came from a TL user named Biased.
People thinking they knew exactly what they want, most of the time have no idea what they can get.
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2018-12-30 16:28:43
December 30 2018 15:51 GMT
#642
On December 30 2018 21:33 MockHamill wrote:
I do not think the ban matter much.

There is almost no strategic discussion here, just copy what the pros do or be silent.

TL has stopped being the place for SC2 discussion a long time ago. Everyone has moved to reddit or bnet, here anything that slightly controversial will result in a locked thread.

nah, I find TL is a decent place for SC2 strategy discussion. The signal to noise ratio is low. However, that signal can not be found any where else. 5+ years ago there were other places (GameReplays.org) to engage in decent SC2 discussions. This is no longer the case. TL.Net is the only game in town.

For the record, in 2018 there were 3, count-em 3, SC2 posts on GR.Org.

On December 30 2018 21:33 MockHamill wrote:
TL has stopped being the place for SC2 discussion a long time ago. Everyone has moved to reddit or bnet, here anything that slightly controversial will result in a locked thread.

you can't really get stuff like this any where else man.
https://www.teamliquid.net/forum/sc2-strategy/522790-pig-strategy-articles-a-terran-build-for-beginners

i used this as the foundations of my teachings to get a 48 year old woman with no RTS experience into Gold League. Her APM hovers around 60.

Pig is very, very good at teaching beginners and TL is very solid for recognizing how good his stuff is.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
WaesumNinja
Profile Joined February 2012
210 Posts
December 31 2018 13:49 GMT
#643
On December 30 2018 22:29 Kevin_Sorbo wrote:
Show nested quote +
On December 30 2018 20:06 FrkFrJss wrote:
You probably found already, but for anyone who's wondering, here it is:

https://www.teamliquid.net/forum/sc2-tournaments/523124-avilo-balance-mod-tournament-800-prize-pool

It had....a less than stellar reception by a lot of people.


Avilo held an 800$ tournament after he raised 3k+ out of a 3500$ goal to go to DH Austin in 2017. He raised funds to travel to the event with his gf of the time but in the end 3k+ was not enough for a weekend in Austin so he pulled the plug on the project. You can understand why the 800$ tournament was not well received.



I mean not really. He didn't raise funds to go to Austin, he just made it a subscription/donation goal.

Saying all of those 3k were specifically donated to get him to DH is misleading because it includes all donations and subscriptions for that month and it's hard to believe he wouldn't be getting any of those without the goal.

As with any subscription goal, be it "I'll color my hair blue if I get x amount" or whatever, nothing special tends to happen when it's not met and I've never heard of such donations be refunded if it doesn't reach the target. He was never obligated to use all of his income that month on a prize pool.
Charoisaur
Profile Joined August 2014
Germany16062 Posts
December 31 2018 16:11 GMT
#644
On December 30 2018 21:33 MockHamill wrote:
I do not think the ban matter much.

There is almost no strategic discussion here, just copy what the pros do or be silent.

TL has stopped being the place for SC2 discussion a long time ago. Everyone has moved to reddit or bnet, here anything that slightly controversial will result in a locked thread.

You know that avilo is banned on reddit and bnet as well?
Many of the coolest moments in sc2 happen due to worker harassment
Loccstana
Profile Blog Joined November 2012
United States833 Posts
Last Edited: 2019-01-02 22:41:29
January 02 2019 22:41 GMT
#645
On January 01 2019 01:11 Charoisaur wrote:
Show nested quote +
On December 30 2018 21:33 MockHamill wrote:
I do not think the ban matter much.

There is almost no strategic discussion here, just copy what the pros do or be silent.

TL has stopped being the place for SC2 discussion a long time ago. Everyone has moved to reddit or bnet, here anything that slightly controversial will result in a locked thread.

You know that avilo is banned on reddit and bnet as well?


For what was he banned for? Can you show me the post that caused it?
[url]http://i.imgur.com/lw2yN.jpg[/url]
nightowl879
Profile Joined November 2018
7 Posts
January 03 2019 03:08 GMT
#646
I'd like to see it as well.
Charoisaur
Profile Joined August 2014
Germany16062 Posts
January 04 2019 02:27 GMT
#647
On January 03 2019 07:41 Loccstana wrote:
Show nested quote +
On January 01 2019 01:11 Charoisaur wrote:
On December 30 2018 21:33 MockHamill wrote:
I do not think the ban matter much.

There is almost no strategic discussion here, just copy what the pros do or be silent.

TL has stopped being the place for SC2 discussion a long time ago. Everyone has moved to reddit or bnet, here anything that slightly controversial will result in a locked thread.

You know that avilo is banned on reddit and bnet as well?


For what was he banned for? Can you show me the post that caused it?

just google "avilo banned from bnet/reddit"
Many of the coolest moments in sc2 happen due to worker harassment
AlgeriaT
Profile Joined April 2010
Sweden2197 Posts
January 04 2019 11:18 GMT
#648
On January 03 2019 07:41 Loccstana wrote:
Show nested quote +
On January 01 2019 01:11 Charoisaur wrote:
On December 30 2018 21:33 MockHamill wrote:
I do not think the ban matter much.

There is almost no strategic discussion here, just copy what the pros do or be silent.

TL has stopped being the place for SC2 discussion a long time ago. Everyone has moved to reddit or bnet, here anything that slightly controversial will result in a locked thread.

You know that avilo is banned on reddit and bnet as well?


For what was he banned for? Can you show me the post that caused it?


From The Automated Ban List thread:

On December 24 2018 15:30 The_Templar wrote:
Show nested quote +
On December 24 2018 11:22 DarkPlasmaBall wrote:
On December 23 2018 12:32 Solar424 wrote:
Wow, Avilo finally got permed.


What was the post/ thread/ balance whine that finally broke the moderator's back?

Technically, it was this one, but no one post could accurately describe his terrible posting history, which in this case is much more important.

CORN GIRL + Flash + FanTaSy + CholeraSC + iNcontroL 4 eva <3
Whatson
Profile Blog Joined January 2012
United States5357 Posts
January 04 2019 22:27 GMT
#649
avilo's reddit ban from 2017: https://www.reddit.com/r/starcraft/comments/6gw2gg/avilo_banned_from_starcraft_subreddit/

¯\_(シ)_/¯
Alejandrisha
Profile Blog Joined July 2010
United States6565 Posts
January 05 2019 04:49 GMT
#650
On January 05 2019 07:27 Whatson wrote:
avilo's reddit ban from 2017: https://www.reddit.com/r/starcraft/comments/6gw2gg/avilo_banned_from_starcraft_subreddit/



he's the only streamer i have ever seen in my life say to his viewers 'go post about that on [enter forum name]'
among many other things....
get rich or die mining
TL+ Member
FFW_Rude
Profile Blog Joined November 2010
France10201 Posts
January 05 2019 13:59 GMT
#651
On December 29 2018 20:34 WaesumNinja wrote:
Show nested quote +
On December 29 2018 14:45 Carminedust wrote:
On December 28 2018 23:36 FFW_Rude wrote:
He's banned ? No reason to read community updates past the OP anymore

i have found another person that feels the same way as i do xD


Oh don't kid yourself, you already know what he'd say anyway.


Wrong it was always surprising !
#1 KT Rolster fanboy. KT BEST KT ! Hail to KT playoffs Zergs ! Unofficial french translator for SlayerS_`Boxer` biography "Crazy as me".
AlgeriaT
Profile Joined April 2010
Sweden2197 Posts
February 03 2019 04:34 GMT
#652
Did he get banned from Twitter too?
CORN GIRL + Flash + FanTaSy + CholeraSC + iNcontroL 4 eva <3
Terra1
Profile Joined June 2018
Philippines312 Posts
February 03 2019 04:44 GMT
#653
On February 03 2019 13:34 AlgeriaT wrote:
Did he get banned from Twitter too?

I guess he got banned there too. He's no longer showing in Twitter for me. But why target him in Twitter too and who requested to ban him there as well?
Jealous
Profile Blog Joined December 2011
10313 Posts
February 03 2019 06:03 GMT
#654
On February 03 2019 13:44 Terra1 wrote:
Show nested quote +
On February 03 2019 13:34 AlgeriaT wrote:
Did he get banned from Twitter too?

I guess he got banned there too. He's no longer showing in Twitter for me. But why target him in Twitter too and who requested to ban him there as well?

Hith thoughth should not be silenthed!
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
AlgeriaT
Profile Joined April 2010
Sweden2197 Posts
February 03 2019 15:59 GMT
#655
On February 03 2019 13:44 Terra1 wrote:
Show nested quote +
On February 03 2019 13:34 AlgeriaT wrote:
Did he get banned from Twitter too?

I guess he got banned there too. He's no longer showing in Twitter for me. But why target him in Twitter too and who requested to ban him there as well?

His account seems to be visible again so maybe it was just down for review. He's been bombarding Atira with aggressive tweets so it probably has to do with that. It seems she finally had enough though:
CORN GIRL + Flash + FanTaSy + CholeraSC + iNcontroL 4 eva <3
terribleplayer1
Profile Joined July 2018
95 Posts
February 05 2019 22:09 GMT
#656
What happened to avi's stream?
Balosaar
Profile Joined August 2012
United States35 Posts
February 06 2019 00:39 GMT
#657
His stream is about to get perma banned from twitch for constantly and unrelentingly harassing a female streamer.... So much so, that she doesn't want to stream anymore. https://imgur.com/a/rOO8VCt

Avilo continues to harass her on twitter, and in private DM's, where she has tried to block him.
https://www.twitch.tv/videos/373098212?t=55m45s

Avilo hasn't streamed for over a week, but it hasn't stopped him from talking shit in his twitch chat
ctrl + f
atira
https://overrustlelogs.net/stalk?channel=avilo&nick=avilo

Hard to believe after driving Maria off the internet, he's going to do it again to another woman. People talk about the lack of women in gaming and esports, and then there are people like Avilo who get hyper possessive and obsessed and drive them away.
2014 WCS Champion StarTale Life ... Best Zerg of Heart of the Swarm
Jealous
Profile Blog Joined December 2011
10313 Posts
February 06 2019 02:52 GMT
#658
On February 06 2019 09:39 Balosaar wrote:
Hard to believe after driving Maria off the internet, he's going to do it again to another woman.

This is avilo we're talking about, so no it isn't.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
arb
Profile Blog Joined April 2008
Noobville17922 Posts
February 06 2019 04:48 GMT
#659
On February 06 2019 11:52 Jealous wrote:
Show nested quote +
On February 06 2019 09:39 Balosaar wrote:
Hard to believe after driving Maria off the internet, he's going to do it again to another woman.

This is avilo we're talking about, so no it isn't.

Ya not a surprise, disgusting individual tbh.
Artillery spawned from the forges of Hell
getg00d
Profile Joined April 2017
United States120 Posts
February 06 2019 05:55 GMT
#660
On February 06 2019 11:52 Jealous wrote:
Show nested quote +
On February 06 2019 09:39 Balosaar wrote:
Hard to believe after driving Maria off the internet, he's going to do it again to another woman.

This is avilo we're talking about, so no it isn't.

Dude,,,your name is soooo puurrffff....
https://www.twitch.tv/getg00d
MockHamill
Profile Joined March 2010
Sweden1798 Posts
Last Edited: 2019-02-06 08:52:21
February 06 2019 08:47 GMT
#661
It seems like some obsessive Avilo stalkers try to create drama between Avilo and a female streamer.
They did the same thing with Maria, and now they repeat the attack. They also try to pretend to be Avilo in chat etc.

That said Avilo seems to get too obsessed with women and have problems letting go. If I was Avilo I would just back off the whole situation, it is not worth it wasting your life on drama.

His stream is one of the few SC streams I enjoy watching so I hope he can get back to streaming.
terribleplayer1
Profile Joined July 2018
95 Posts
February 10 2019 19:23 GMT
#662
Seems like his twitch is gone.

RIP so much entertainment with the hacker/sniper/swarmhost/protoss whining.
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2019-02-10 20:44:35
February 10 2019 20:44 GMT
#663
On December 28 2018 11:57 JimmiC wrote:
Who knew avilo attracted the tinfoil hat crowd. What if avilo asked to be banned so he could get more street cred and get a boost of popularity. Or what if its just what the mods say it was. We may never know....

A rather entertaining theory. However, i think we now know the answer.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
StabiloBoss20
Profile Joined July 2015
313 Posts
February 10 2019 21:22 GMT
#664
On February 11 2019 04:23 terribleplayer1 wrote:
Seems like his twitch is gone.



i know it sounds weird: Good for him. Seriously.
phodacbiet
Profile Joined August 2010
United States1740 Posts
February 10 2019 21:59 GMT
#665
Yikes, I really hope he doesn't hurt himself or others over this.
sM.Zik
Profile Joined June 2011
Canada2550 Posts
February 10 2019 22:01 GMT
#666
Good riddance.. never understood the appeal of his stream tbh.
Jaedong Fighting! | youtube.com/ZikGaming
Elmonti
Profile Joined July 2018
Spain299 Posts
February 10 2019 22:24 GMT
#667
On February 11 2019 07:01 sM.Zik wrote:
Good riddance.. never understood the appeal of his stream tbh.


Those who find his stream funny or entertaining probably share a few aspects of his personality. Starcraft is better off without him, no question.
Ryu3600
Profile Joined January 2016
Canada469 Posts
February 10 2019 22:51 GMT
#668
I like how people are posting that they are glad he is gone on his fan club page
Maru is the best Terran ever.
Jealous
Profile Blog Joined December 2011
10313 Posts
February 10 2019 23:10 GMT
#669
On February 11 2019 07:51 Ryu3600 wrote:
I like how people are posting that they are glad he is gone on his fan club page

I feel like a lot of people who watched/followed him and would be superficially considered "fans" were not the type of "fans" that most gamers have, to put it gently - partly because avilo was not like "most gamers." He was... special.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
Arden
Profile Joined July 2018
United States15 Posts
February 10 2019 23:31 GMT
#670
He was definitely infamous. I was only a "fan" in the sense that you can't help but glance at the covers of those insane tabloids by the grocery checkout stand.
I love to play and watch Starcraft! I love Liquid Hero, Polt, and Hyun
getg00d
Profile Joined April 2017
United States120 Posts
February 11 2019 10:47 GMT
#671
<3
https://www.twitch.tv/getg00d
uiotui
Profile Joined February 2010
United States54 Posts
Last Edited: 2019-02-12 00:46:55
February 11 2019 17:05 GMT
#672
KappaKingPrime
Profile Joined May 2014
United States468 Posts
February 11 2019 20:03 GMT
#673
Is this like 3rd time he got banned? This one might be permanent.
Valikyr
Profile Joined June 2010
Sweden2653 Posts
Last Edited: 2019-02-11 22:08:23
February 11 2019 22:08 GMT
#674
On February 11 2019 07:51 Ryu3600 wrote:
I like how people are posting that they are glad he is gone on his fan club page

To be honest it might be the best thing for him in the long run. It seems like he's not been in a good place for a long time (admittedly I don't watch any of his stuff, I just can't help but to read the drama when it pops up in my feed) and getting an education or just a normal job would be much healthier for him.
KT_Elwood
Profile Joined July 2015
Germany1150 Posts
February 12 2019 07:13 GMT
#675
Avilo is actually retarded in his developement, he was not faking anything for the memes.



User was warned for this post.
"First he eats our dogs, and then he taxes the penguins... Donald Trump truly is the Donald Trump of our generation. " -DPB
DeepElemBlues
Profile Blog Joined January 2011
United States5079 Posts
Last Edited: 2019-02-13 06:58:18
February 13 2019 06:57 GMT
#676
he obviously has some emotional problems that he needs help with but he also revels in and feeds them until they get him into a hole so deep he can't keep up the facade and crumbles into utter despair.

avilo being crazy because on some level he enjoys it -> avilo fights the consequences with more crazy -> avilo realizes he done screwed up big-time and goes into a black hole of depression -> repeat

it's hard to feel bad for him and also not hard to feel bad for him
no place i'd rather be than the satellite of love
Jealous
Profile Blog Joined December 2011
10313 Posts
Last Edited: 2019-02-13 11:08:04
February 13 2019 11:07 GMT
#677
On February 13 2019 15:57 DeepElemBlues wrote:
it's hard to feel bad for him and also not hard to feel bad for him

Pretty much. Does anyone know what he can do with himself outside of this? Does he have any skills or education? I find it hard to believe that he can land a job when you consider that the other applicants won't talk like dith.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
freelifeffs
Profile Joined April 2018
97 Posts
February 13 2019 13:02 GMT
#678
he as a degree in computer science afaik
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2019-02-13 13:15:21
February 13 2019 13:14 GMT
#679
On February 13 2019 20:07 Jealous wrote:
Show nested quote +
On February 13 2019 15:57 DeepElemBlues wrote:
it's hard to feel bad for him and also not hard to feel bad for him

Pretty much. Does anyone know what he can do with himself outside of this? Does he have any skills or education? I find it hard to believe that he can land a job when you consider that the other applicants won't talk like dith.

I think he lives in the north eastern USA. Right now, the economy in the north eastern USA is absolutely ROCKIN'.

So if he is ever going to jump off the full time Streamer train.. now is the time. Expecting the current economic opportunities in the north eastern USA to continue forever is a bad bet. Now, is the time for Avilo. In a way, this Twitch ban might be a blessing in disguise for him.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
avilopresident
Profile Joined July 2018
3 Posts
February 13 2019 14:15 GMT
#680
Thats will be a good thing for Avilo this definitive BAN.
He's 31yo, its time for him to get a real job and not stream 8 hours a day for being 5.2K NA.
He will find a real job, and will leave finally his parent's house !

At 31yo, thats not normal to play video game 8 hours a day...
MockHamill
Profile Joined March 2010
Sweden1798 Posts
February 14 2019 14:25 GMT
#681
So do we know if this ban was a perma-ban or not? Or is it like the last time when he was banned for 30 days?
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2019-02-14 16:05:27
February 14 2019 15:37 GMT
#682
On February 14 2019 23:25 MockHamill wrote:
So do we know if this ban was a perma-ban or not? Or is it like the last time when he was banned for 30 days?

FWIW, I noticed he is putting non-SC2 content on his youtube channel the last few days.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
agripsss
Profile Joined June 2018
37 Posts
February 17 2019 15:33 GMT
#683
does this mean avilo got permbanned?
MockHamill
Profile Joined March 2010
Sweden1798 Posts
February 17 2019 21:13 GMT
#684
Hi is back!! Or at least his twitch account has been un-banned:
https://www.twitch.tv/avilo

This is great, have not watched any SC2 since he got banned. Netflix is good but I need some SC2 entertainment.
Jealous
Profile Blog Joined December 2011
10313 Posts
February 17 2019 22:56 GMT
#685
On February 18 2019 06:13 MockHamill wrote:
Hi is back!! Or at least his twitch account has been un-banned:
https://www.twitch.tv/avilo

This is great, have not watched any SC2 since he got banned. Netflix is good but I need some SC2 entertainment.

Since you seem to be a genuine fan, may I ask what you enjoy about his stream over other streamers?
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
MockHamill
Profile Joined March 2010
Sweden1798 Posts
Last Edited: 2019-02-18 06:16:55
February 18 2019 06:15 GMT
#686
On February 18 2019 07:56 Jealous wrote:
Show nested quote +
On February 18 2019 06:13 MockHamill wrote:
Hi is back!! Or at least his twitch account has been un-banned:
https://www.twitch.tv/avilo

This is great, have not watched any SC2 since he got banned. Netflix is good but I need some SC2 entertainment.

Since you seem to be a genuine fan, may I ask what you enjoy about his stream over other streamers?


He is the most entertaining SC2 streamer by far.
It is like watching the Republication nomination. Most of the other nominees were probably better suited to be President, but Trump was the most entertaining, so he won.

I like that Avilo is the very antithesis of a faceless programmer. Instead of the robotic "I need to practice harder" reaction to a loss he blames balance or his cheating opponents. It is very human response that, while counterproductive if your only goal is to improve, is more relatable then the pro-gamer reaction.

I also learn a lot by watching his stream. His play style rely more on understanding the game than mechanics, which makes it easier to copy. I could never copy what Innovation does since I do not have the APM to do what he does but I do learn from Avilos decision making.

But primarily I watch just because he is more entertaining.


Jealous
Profile Blog Joined December 2011
10313 Posts
February 18 2019 06:49 GMT
#687
On February 18 2019 15:15 MockHamill wrote:
Show nested quote +
On February 18 2019 07:56 Jealous wrote:
On February 18 2019 06:13 MockHamill wrote:
Hi is back!! Or at least his twitch account has been un-banned:
https://www.twitch.tv/avilo

This is great, have not watched any SC2 since he got banned. Netflix is good but I need some SC2 entertainment.

Since you seem to be a genuine fan, may I ask what you enjoy about his stream over other streamers?


He is the most entertaining SC2 streamer by far.
It is like watching the Republication nomination. Most of the other nominees were probably better suited to be President, but Trump was the most entertaining, so he won.

I like that Avilo is the very antithesis of a faceless programmer. Instead of the robotic "I need to practice harder" reaction to a loss he blames balance or his cheating opponents. It is very human response that, while counterproductive if your only goal is to improve, is more relatable then the pro-gamer reaction.

I also learn a lot by watching his stream. His play style rely more on understanding the game than mechanics, which makes it easier to copy. I could never copy what Innovation does since I do not have the APM to do what he does but I do learn from Avilos decision making.

But primarily I watch just because he is more entertaining.



Thank you for the thorough answer.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
freelifeffs
Profile Joined April 2018
97 Posts
February 18 2019 13:59 GMT
#688
its such a joke how this guy gets unbanned again and again despite his horrific behaviour yet other streamers get legit permad for much less if anything at all (example: helenalive gets permabanned for saying there is only two genders). this is borderline despotism and indoctrination. im disgusted by twitch tbh.
uiotui
Profile Joined February 2010
United States54 Posts
Last Edited: 2019-02-18 22:42:44
February 18 2019 19:10 GMT
#689
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
February 18 2019 21:32 GMT
#690
On February 19 2019 04:10 uiotui wrote:
wb little buddy!

his name is Avilo, not gilligan.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
Apollo_Shards
Profile Joined February 2011
1210 Posts
February 19 2019 10:32 GMT
#691
On February 18 2019 22:59 freelifeffs wrote:
its such a joke how this guy gets unbanned again and again despite his horrific behaviour yet other streamers get legit permad for much less if anything at all (example: helenalive gets permabanned for saying there is only two genders). this is borderline despotism and indoctrination. im disgusted by twitch tbh.


Gamers are truly the most oppressed, thank you for speaking out when no one else will
Jaedong, sOs, avilo, MaSa, Oprah
castleeMg
Profile Blog Joined January 2013
Canada786 Posts
February 19 2019 16:06 GMT
#692
How did he not get permabanned in 2012. This guy is a complete narcissistic scumbag who talks big and mean online but couldn’t fight his way out of a wet paper bag in real life. There are 12 year olds with more maturity than this PoS. The people who support this idiot are also degenerates

User was warned for this post
AKA: castle[eMg]@USEast/ iCCup
Dangermousecatdog
Profile Joined December 2010
United Kingdom7084 Posts
Last Edited: 2019-02-19 19:33:47
February 19 2019 19:33 GMT
#693
Would it matter if he could fight in real life? If he was big and mean in real life? Avilo exhibits despicable behaviour, but I don't understand the need to denigrate his physical appearance.
Elmonti
Profile Joined July 2018
Spain299 Posts
Last Edited: 2019-02-19 19:59:30
February 19 2019 19:58 GMT
#694
On February 20 2019 04:33 Dangermousecatdog wrote:
Would it matter if he could fight in real life? If he was big and mean in real life? Avilo exhibits despicable behaviour, but I don't understand the need to denigrate his physical appearance.


I agree. There are tons of reasons he should be as far as possible from SC2 and Twitch, and non of them are related to his appearance. Once again, Twitch support showing that they don't really give a shit about this... maybe they need an actual restraining order so that they ban him once and for all... and I'm not ruling that out tbh.
castleeMg
Profile Blog Joined January 2013
Canada786 Posts
February 19 2019 20:34 GMT
#695
all i was saying was, he'll call you a retard, idiot ect ect behind his keyboard because hes in his safe space in mommys house. im sure he'd stay really quite in real life to 100% of the people he talks shit to online
AKA: castle[eMg]@USEast/ iCCup
DreamlnCode
Profile Joined December 2018
United Kingdom77 Posts
February 20 2019 00:14 GMT
#696
Well his Twitch account is functional again.
Jealous
Profile Blog Joined December 2011
10313 Posts
February 20 2019 00:19 GMT
#697
On February 20 2019 05:34 castleeMg wrote:
all i was saying was, he'll call you a retard, idiot ect ect behind his keyboard because hes in his safe space in mommys house. im sure he'd stay really quite in real life to 100% of the people he talks shit to online

Even if he was a brolic bodybuilder or MMA fighter, he still shouldn't be talking shit tbh. He probably talks shit not in ignorance of his body shape or irritating lisp, but as a result of ignorance in general.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
Kevin_Sorbo
Profile Joined November 2011
Canada3217 Posts
February 20 2019 00:22 GMT
#698
On February 20 2019 01:06 castleeMg wrote:
How did he not get permabanned in 2012. This guy is a complete narcissistic scumbag who talks big and mean online but couldn’t fight his way out of a wet paper bag in real life. There are 12 year olds with more maturity than this PoS. The people who support this idiot are also degenerates

User was warned for this post



you don't support avilo, you enable him. Guy delivered some good memes over the years but all good things come to an end. He needs help before he gets into real trouble. He is the master of self inflicted wounds at this point.
The mind is like a parachute, it doesnt work unless its open. - Zappa
uiotui
Profile Joined February 2010
United States54 Posts
February 22 2019 21:37 GMT
#699
will he be at katowice? thinking about hopping on the train
getg00d
Profile Joined April 2017
United States120 Posts
February 23 2019 01:15 GMT
#700
Do not ya'll think you've been over-reacting to this whole 'harassing-akira' drama?

I think twitch thinks ya'll have been, and that is why he (Avilo) was reinstated.
https://www.twitch.tv/getg00d
blunderfulguy
Profile Blog Joined April 2016
United States1415 Posts
February 23 2019 21:49 GMT
#701
On February 23 2019 10:15 getg00d wrote:
Do not ya'll think you've been over-reacting to this whole 'harassing-akira' drama?

I think twitch thinks ya'll have been, and that is why he (Avilo) was reinstated.

"Do not ya'll think you've been over-reacting to-" a repeat stalker and harasser? No. Nope, not at all. I think you (and Twitch) are grossly underestimating the impact that they and their toxic community have on Twitch, have on the broadcaster themselves, and have on TL and social media and so on.

It isn't just "some drama," it's complete and total bullshit that makes people feel unsafe to an extreme degree that some people will apparently never be able to comprehend. In my and most sensible peoples' opinions, it is a thing that has no place in the world save for the ocassional blood-curdling horror story.
Blunder Man doing everything thing a blunder can.
getg00d
Profile Joined April 2017
United States120 Posts
February 24 2019 14:18 GMT
#702
On February 24 2019 06:49 blunderfulguy wrote:
Show nested quote +
On February 23 2019 10:15 getg00d wrote:
Do not ya'll think you've been over-reacting to this whole 'harassing-akira' drama?

I think twitch thinks ya'll have been, and that is why he (Avilo) was reinstated.

"Do not ya'll think you've been over-reacting to-" a repeat stalker and harasser? No. Nope, not at all. I think you (and Twitch) are grossly underestimating the impact that they and their toxic community have on Twitch, have on the broadcaster themselves, and have on TL and social media and so on.

It isn't just "some drama," it's complete and total bullshit that makes people feel unsafe to an extreme degree that some people will apparently never be able to comprehend. In my and most sensible peoples' opinions, it is a thing that has no place in the world save for the ocassional blood-curdling horror story.

Oh the HUMANITY!
exaggerate much?
https://www.twitch.tv/getg00d
Alejandrisha
Profile Blog Joined July 2010
United States6565 Posts
February 24 2019 20:58 GMT
#703
On February 24 2019 23:18 getg00d wrote:
Show nested quote +
On February 24 2019 06:49 blunderfulguy wrote:
On February 23 2019 10:15 getg00d wrote:
Do not ya'll think you've been over-reacting to this whole 'harassing-akira' drama?

I think twitch thinks ya'll have been, and that is why he (Avilo) was reinstated.

"Do not ya'll think you've been over-reacting to-" a repeat stalker and harasser? No. Nope, not at all. I think you (and Twitch) are grossly underestimating the impact that they and their toxic community have on Twitch, have on the broadcaster themselves, and have on TL and social media and so on.

It isn't just "some drama," it's complete and total bullshit that makes people feel unsafe to an extreme degree that some people will apparently never be able to comprehend. In my and most sensible peoples' opinions, it is a thing that has no place in the world save for the ocassional blood-curdling horror story.

Oh the HUMANITY!
exaggerate much?

we don't want him here. go watch him stream no one is stopping you. he's just not welcome here. also, when his fans say they like him for the 'memes..' does 'memes' refer to some kind of mental condition
get rich or die mining
TL+ Member
Alejandrisha
Profile Blog Joined July 2010
United States6565 Posts
February 24 2019 21:01 GMT
#704
On February 23 2019 10:15 getg00d wrote:
Do not ya'll think you've been over-reacting to this whole 'harassing-akira' drama?

I think twitch thinks ya'll have been, and that is why he (Avilo) was reinstated.


some one being lenient to some one harassing some one gives no one any impetus to grant commensurate amnesty. believe it or not a lot of people on this forum don't approve of manipulation or harassment of the few females who dare put themselves into such a male-dominated sphere
get rich or die mining
TL+ Member
uiotui
Profile Joined February 2010
United States54 Posts
February 24 2019 23:53 GMT
#705
the sun come out, avilo... bet your bottom dollar it's aviloooooooo
Alejandrisha
Profile Blog Joined July 2010
United States6565 Posts
February 25 2019 09:52 GMT
#706
get out

User was warned for this post
get rich or die mining
TL+ Member
getg00d
Profile Joined April 2017
United States120 Posts
February 26 2019 04:30 GMT
#707
On February 25 2019 06:01 Alejandrisha wrote:
Show nested quote +
On February 23 2019 10:15 getg00d wrote:
Do not ya'll think you've been over-reacting to this whole 'harassing-akira' drama?

I think twitch thinks ya'll have been, and that is why he (Avilo) was reinstated.


some one being lenient to some one harassing some one gives no one any impetus to grant commensurate amnesty. believe it or not a lot of people on this forum don't approve of manipulation or harassment of the few females who dare put themselves into such a male-dominated sphere

Do not conflate 'condoning' harassment, with simply looking at things objectively.
https://www.twitch.tv/getg00d
KappaKingPrime
Profile Joined May 2014
United States468 Posts
February 26 2019 21:55 GMT
#708
Looks like Avilo has been removed from featured SC2 streams.
PinoKotsBeer
Profile Joined February 2014
Netherlands1385 Posts
Last Edited: 2019-02-26 23:20:02
February 26 2019 23:18 GMT
#709
On February 27 2019 06:55 KappaKingPrime wrote:
Looks like Avilo has been removed from featured SC2 streams.

Good move by TL
http://www.twitch.tv/pinokotsbeer
Balosaar
Profile Joined August 2012
United States35 Posts
February 27 2019 00:00 GMT
#710
The next move: they lock this forum thread.

He's banned from starcraft reddit, blizzard forums, and TL forums. He is one infraction away from a permanent ban on twitch.

With the lack of respect Avilo has given the community, I feel like TL has no obligation to have him as a featured streamer, or even acknowledge his existence.
2014 WCS Champion StarTale Life ... Best Zerg of Heart of the Swarm
MockHamill
Profile Joined March 2010
Sweden1798 Posts
February 27 2019 09:19 GMT
#711
I am glad he is back. He is the only streamer I find entertaining.

Weavel
Profile Joined January 2010
Finland9223 Posts
February 27 2019 11:17 GMT
#712
On February 27 2019 18:19 MockHamill wrote:
I am glad he is back. He is the only streamer I find entertaining.

Yeah it's been boring 18 days without the daily dose of Avilo. 11 days to go...
Life/Seed//Mvp/NaNiwa fighting! ZeNEX forever!
Charoisaur
Profile Joined August 2014
Germany16062 Posts
February 27 2019 11:45 GMT
#713
On February 27 2019 06:55 KappaKingPrime wrote:
Looks like Avilo has been removed from featured SC2 streams.

yeah it was announced here
Many of the coolest moments in sc2 happen due to worker harassment
MockHamill
Profile Joined March 2010
Sweden1798 Posts
February 27 2019 12:04 GMT
#714
On February 27 2019 20:17 Weavel wrote:
Show nested quote +
On February 27 2019 18:19 MockHamill wrote:
I am glad he is back. He is the only streamer I find entertaining.

Yeah it's been boring 18 days without the daily dose of Avilo. 11 days to go...


Actually he streamed yesterday so the ban has already been lifted.
uiotui
Profile Joined February 2010
United States54 Posts
February 27 2019 17:59 GMT
#715
hopefully trump retweets him next time he tweets he's gone live
DeepElemBlues
Profile Blog Joined January 2011
United States5079 Posts
Last Edited: 2019-02-27 18:14:23
February 27 2019 18:14 GMT
#716
if avilo could just keep his trolling on stream to balance and none on drama he'd be fine
no place i'd rather be than the satellite of love
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2019-02-28 00:39:06
February 28 2019 00:38 GMT
#717
i think TL.Net senior mods kept Avilo around for teaching purposes for the junior MODs. Senior mods can provide a concrete demonstration of where to draw the line when MODerating the site using Avilo as a good test case for his many "idiosyncrasies"

IMO, Avilo is a big reason why the TL.Net site has top notch moderation... he has provided many fantastic teaching moments for the junior mods to learn from the senior mods.

This is his Fan Club thread so I'm just trying to view the guy from as positive a viewpoint as possible.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
Jealous
Profile Blog Joined December 2011
10313 Posts
February 28 2019 00:46 GMT
#718
^ Tinfoil hat in the SC2 universe.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
Carminedust
Profile Joined October 2014
487 Posts
Last Edited: 2019-03-01 05:35:52
March 01 2019 05:34 GMT
#719
guess this club is all thats left for all things that is Avilo on TL
Maybe was Zoun only Fan before he retired idk
uiotui
Profile Joined February 2010
United States54 Posts
Last Edited: 2019-03-02 01:28:51
March 01 2019 21:40 GMT
#720
SoupedUpHellion
Profile Joined January 2019
20 Posts
March 02 2019 03:11 GMT
#721
Complete bullshit they removed one of the few good sc2 streamers left.
blunderfulguy
Profile Blog Joined April 2016
United States1415 Posts
March 02 2019 06:14 GMT
#722
On March 02 2019 12:11 SoupedUpHellion wrote:
Complete bullshit they removed one of the few good sc2 streamers left.

Oh that's too bad, who did they remove? Oh- oh wait, you mean the undeniably most toxic person infecting the community who harasses women to the point of them being afraid that they will be stalked in real life and have their lives endangered?

I dunno dawg, that doesn't sound like "good sc2 streamer" to me or bullshit to remove them, but I guess people who follow and support them aren't known for having a great understanding of what words mean. Bullshit, hacker, viable... Anywho.
Blunder Man doing everything thing a blunder can.
uiotui
Profile Joined February 2010
United States54 Posts
Last Edited: 2019-03-02 15:09:24
March 02 2019 15:07 GMT
#723
woot ESL gogooooooo zerg or something, why did it get defeatured?
Weavel
Profile Joined January 2010
Finland9223 Posts
March 02 2019 15:12 GMT
#724
Avilo radiocasting saving IEM
Life/Seed//Mvp/NaNiwa fighting! ZeNEX forever!
Elantris
Profile Joined June 2018
66 Posts
March 03 2019 19:52 GMT
#725
Is this the first time somebody got demoted from featured to non-featured plebs?
SPcrusader
Profile Joined September 2011
Norway99 Posts
March 03 2019 20:17 GMT
#726
He is streaming right NOW!
https://www.twitch.tv/spcrusader
MockHamill
Profile Joined March 2010
Sweden1798 Posts
March 03 2019 21:32 GMT
#727
I rather watch avilo than wcs especielly when every single Terran gets eliminated. Maybe if Blizzard do something to help Terran I will start watching again.

User was warned for this post.
Balosaar
Profile Joined August 2012
United States35 Posts
March 15 2019 00:16 GMT
#728
I find it interesting how he was banned for a week from twitch for harassment, and today he was going at it again.

It is EXTREMELY interesting that she claims she called the police on him, and the police told him to stop.
https://cdn.discordapp.com/attachments/544238194229772309/555786750690328618/policetira.PNG

Even after being told to leave her alone, being blocked everywhere by her, and a week ban... He thinks he can still be friends with her. He keeps bringing her up on stream and commenting about how she should unban him from her twitch chat. It's quite sad how obsessed he is with her.

I thought he had moved on, but he's still thinks she is just going to unblock, unban, and remod him in her chat. How long can a delusional liar harass a woman on the internet in 2019 without being punished?

(he goes on for several minutes https://www.twitch.tv/videos/395240554?t=16h33m48s )


2014 WCS Champion StarTale Life ... Best Zerg of Heart of the Swarm
Elmonti
Profile Joined July 2018
Spain299 Posts
March 15 2019 08:59 GMT
#729
On March 15 2019 09:16 Balosaar wrote:
I find it interesting how he was banned for a week from twitch for harassment, and today he was going at it again.

It is EXTREMELY interesting that she claims she called the police on him, and the police told him to stop.
https://cdn.discordapp.com/attachments/544238194229772309/555786750690328618/policetira.PNG

Even after being told to leave her alone, being blocked everywhere by her, and a week ban... He thinks he can still be friends with her. He keeps bringing her up on stream and commenting about how she should unban him from her twitch chat. It's quite sad how obsessed he is with her.

I thought he had moved on, but he's still thinks she is just going to unblock, unban, and remod him in her chat. How long can a delusional liar harass a woman on the internet in 2019 without being punished?

(he goes on for several minutes https://www.twitch.tv/videos/395240554?t=16h33m48s )
https://clips.twitch.tv/DaintyFantasticCamelSoonerLater
https://clips.twitch.tv/AgitatedCaringPrariedogCoolCat
https://clips.twitch.tv/HungryReliableBeaverBrainSlug


"Who cares about harassing women, he is entertaining, right?"...
SoupedUpHellion
Profile Joined January 2019
20 Posts
March 15 2019 13:36 GMT
#730
Balosaar, if you actually watch the stream, its clear that these trolls are people pretending to be Avilo and harassing her, and at the same time doxxing avilo and his family. It's sick. This is not avilo's fault this time, dude. It's people going way too far.
fishjie
Profile Blog Joined September 2010
United States1519 Posts
March 15 2019 17:14 GMT
#731
On March 15 2019 09:16 Balosaar wrote:
I find it interesting how he was banned for a week from twitch for harassment, and today he was going at it again.

It is EXTREMELY interesting that she claims she called the police on him, and the police told him to stop.
https://cdn.discordapp.com/attachments/544238194229772309/555786750690328618/policetira.PNG

Even after being told to leave her alone, being blocked everywhere by her, and a week ban... He thinks he can still be friends with her. He keeps bringing her up on stream and commenting about how she should unban him from her twitch chat. It's quite sad how obsessed he is with her.

I thought he had moved on, but he's still thinks she is just going to unblock, unban, and remod him in her chat. How long can a delusional liar harass a woman on the internet in 2019 without being punished?

(he goes on for several minutes https://www.twitch.tv/videos/395240554?t=16h33m48s )
https://clips.twitch.tv/DaintyFantasticCamelSoonerLater
https://clips.twitch.tv/AgitatedCaringPrariedogCoolCat
https://clips.twitch.tv/HungryReliableBeaverBrainSlug


LOL!

that was super creepy he wouldn't stop talking about her and how he was going to get unbanned

I started looking into this and then found this from a few years ago

https://www.reddit.com/r/LivestreamFail/comments/6ql2rv/avilo_goes_through_a_complete_breakdown_on_stream/

dude is obsessed with these women won't stop talking about them, i thought he was a top tier master troll but looks like he needs help. also harassing women not ok
blunderfulguy
Profile Blog Joined April 2016
United States1415 Posts
March 15 2019 18:06 GMT
#732
There are some reasonable people in his chat, but others talking about her, "trolling" or not, are absolutely disgusting. Not only is his own behavior gross and extremely harmful on its own, but people who watch him follow along or join in with the harassment, treating Atira like a piece of garbage or trophy for the stalker to win. Some think that pointing and laughing at him/the situation isn't bad, but it normalizes harassment by treating it like a comedy show instead of a serious and disturbing, dangerous sitation, then of course more people join in to point and laugh along with them.

Don't spread hate towards Atira and her followers/supporters. Don't expect the stalker to "get over it soon." Don't point and laugh. Just fuckin' stop, people.

Makes me sick...
Blunder Man doing everything thing a blunder can.
AlgeriaT
Profile Joined April 2010
Sweden2197 Posts
Last Edited: 2019-03-15 18:16:18
March 15 2019 18:09 GMT
#733
On March 15 2019 22:36 SoupedUpHellion wrote:
Balosaar, if you actually watch the stream, its clear that these trolls are people pretending to be Avilo and harassing her, and at the same time doxxing avilo and his family. It's sick. This is not avilo's fault this time, dude. It's people going way too far.

It's true that there's a few trolls who stalk Avilo himself and try to worsen the drama by trolling both sides, and yes these are also truly deranged individuals.

That however doesn't change the fact that Avilo himself is the worst case of them all, and definitely the one who starts it all by going further than anyone else does - in particular by dragging any issues he has with these women into public light, by incessant tweeting, ranting and harassing on stream etc.
CORN GIRL + Flash + FanTaSy + CholeraSC + iNcontroL 4 eva <3
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2019-03-16 17:13:09
March 16 2019 17:12 GMT
#734
On March 16 2019 03:09 AlgeriaT wrote:
That however doesn't change the fact that Avilo himself is the worst case of them all, and definitely the one who starts it all by going further than anyone else does - in particular by dragging any issues he has with these women into public light, by incessant tweeting, ranting and harassing on stream etc.

Keep in mind Avilo was paying the first woman to be his "Lead/Top admin" for his twitch channel. So there was a money aspect to their dispute that both Avilo and the woman involved are actively downplaying. Once you realize there is a money aspect their disagreement becomes a lot more boring and a lot more typical.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
Alejandrisha
Profile Blog Joined July 2010
United States6565 Posts
Last Edited: 2019-03-16 19:18:27
March 16 2019 19:17 GMT
#735
On March 17 2019 02:12 JimmyJRaynor wrote:
Show nested quote +
On March 16 2019 03:09 AlgeriaT wrote:
That however doesn't change the fact that Avilo himself is the worst case of them all, and definitely the one who starts it all by going further than anyone else does - in particular by dragging any issues he has with these women into public light, by incessant tweeting, ranting and harassing on stream etc.

Keep in mind Avilo was paying the first woman to be his "Lead/Top admin" for his twitch channel. So there was a money aspect to their dispute that both Avilo and the woman involved are actively downplaying. Once you realize there is a money aspect their disagreement becomes a lot more boring and a lot more typical.

he was paying his mod(s)???? wowowowowo
what a great way to create a subordinate pseudo employee. can we have an honest discussion about this?
get rich or die mining
TL+ Member
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2019-03-16 20:40:53
March 16 2019 20:38 GMT
#736
On March 17 2019 04:17 Alejandrisha wrote:
can we have an honest discussion about this?

why can't we have a dishonest discussion about it?
" now, in all honesty" ....
+ Show Spoiler +

Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
Alejandrisha
Profile Blog Joined July 2010
United States6565 Posts
March 16 2019 22:58 GMT
#737
On March 17 2019 05:38 JimmyJRaynor wrote:
Show nested quote +
On March 17 2019 04:17 Alejandrisha wrote:
can we have an honest discussion about this?

why can't we have a dishonest discussion about it?
" now, in all honesty" ....
+ Show Spoiler +
https://www.youtube.com/watch?v=5BpfomSBz8c&t=6m50s


i'd like to answer this but just scroll further in the thread
get rich or die mining
TL+ Member
uiotui
Profile Joined February 2010
United States54 Posts
Last Edited: 2019-03-18 22:55:16
March 18 2019 16:44 GMT
#738
i just wannan go to atira avilo wedding
DeepElemBlues
Profile Blog Joined January 2011
United States5079 Posts
Last Edited: 2019-03-18 21:14:09
March 18 2019 20:59 GMT
#739
dude cant help himself it's so obvious that he should just stop talking about his multiple dramas entirely and forever but he cant

inevitable twitch will permaban him soon cus he just wont shut up ever and move on

edit and by soon i mean probably today is his last day on twitch
no place i'd rather be than the satellite of love
bretfart
Profile Joined July 2012
114 Posts
March 19 2019 12:30 GMT
#740
On March 19 2019 05:59 DeepElemBlues wrote:
dude cant help himself it's so obvious that he should just stop talking about his multiple dramas entirely and forever but he cant

inevitable twitch will permaban him soon cus he just wont shut up ever and move on

edit and by soon i mean probably today is his last day on twitch


you sure? That would be awesome!
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2019-03-19 13:33:43
March 19 2019 13:30 GMT
#741
On March 17 2019 07:58 Alejandrisha wrote:
Show nested quote +
On March 17 2019 05:38 JimmyJRaynor wrote:
On March 17 2019 04:17 Alejandrisha wrote:
can we have an honest discussion about this?

why can't we have a dishonest discussion about it?
" now, in all honesty" ....
+ Show Spoiler +
https://www.youtube.com/watch?v=5BpfomSBz8c&t=6m50s


i'd like to answer this but just scroll further in the thread

whoever that girl was from Europe. its been so long i can not remember her name. Any how, she was his #1 admin or "head" admin/moderator for a long time. He stated he could not trust any of his Ops/Mods except her so he decided to pay her a small monthly salary and have her control/run/regulate the "mod team" for his channel. i do not think he was paying any other MOD except his #1 head mod but i wasn't paying close enough attention to the silliness to know for sure.

i'm pretty sure several twitch channel broadcasters pay their #1 admin/production person at least some cash. they probably don't discuss it constantly because they don't want to piss off the lower tier admins/mods/production people
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
KelianQatar
Profile Joined December 2012
303 Posts
March 19 2019 13:45 GMT
#742
On March 19 2019 22:30 JimmyJRaynor wrote:
Show nested quote +
On March 17 2019 07:58 Alejandrisha wrote:
On March 17 2019 05:38 JimmyJRaynor wrote:
On March 17 2019 04:17 Alejandrisha wrote:
can we have an honest discussion about this?

why can't we have a dishonest discussion about it?
" now, in all honesty" ....
+ Show Spoiler +
https://www.youtube.com/watch?v=5BpfomSBz8c&t=6m50s


i'd like to answer this but just scroll further in the thread

whoever that girl was from Europe. its been so long i can not remember her name. Any how, she was his #1 admin or "head" admin/moderator for a long time. He stated he could not trust any of his Ops/Mods except her so he decided to pay her a small monthly salary and have her control/run/regulate the "mod team" for his channel. i do not think he was paying any other MOD except his #1 head mod but i wasn't paying close enough attention to the silliness to know for sure.

i'm pretty sure several twitch channel broadcasters pay their #1 admin/production person at least some cash. they probably don't discuss it constantly because they don't want to piss off the lower tier admins/mods/production people



Her name was Maria! I remember!!!
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
March 19 2019 13:52 GMT
#743
On March 19 2019 22:45 KelianQatar wrote:
Show nested quote +
On March 19 2019 22:30 JimmyJRaynor wrote:
On March 17 2019 07:58 Alejandrisha wrote:
On March 17 2019 05:38 JimmyJRaynor wrote:
On March 17 2019 04:17 Alejandrisha wrote:
can we have an honest discussion about this?

why can't we have a dishonest discussion about it?
" now, in all honesty" ....
+ Show Spoiler +
https://www.youtube.com/watch?v=5BpfomSBz8c&t=6m50s


i'd like to answer this but just scroll further in the thread

whoever that girl was from Europe. its been so long i can not remember her name. Any how, she was his #1 admin or "head" admin/moderator for a long time. He stated he could not trust any of his Ops/Mods except her so he decided to pay her a small monthly salary and have her control/run/regulate the "mod team" for his channel. i do not think he was paying any other MOD except his #1 head mod but i wasn't paying close enough attention to the silliness to know for sure.

i'm pretty sure several twitch channel broadcasters pay their #1 admin/production person at least some cash. they probably don't discuss it constantly because they don't want to piss off the lower tier admins/mods/production people

Her name was Maria! I remember!!!

i wonder if that was her real name or if it was all a bunch of BS. who knows.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
fishjie
Profile Blog Joined September 2010
United States1519 Posts
March 19 2019 17:57 GMT
#744
i linked a reddit thread about maria in the previous page:
https://www.reddit.com/r/LivestreamFail/comments/6ql2rv/avilo_goes_through_a_complete_breakdown_on_stream/

he was avilo's "girlfriend" and people were clowning him because she was in europe and they had never met and he got upset and demanded she come online and state that they were in fact dating, of course she didn't, and then he started sobbing hysterically. when asked for any proof that they were "dating" avilo had nothing. apparently all maria did was tweet "<3" and also in chat

i guess similar thing is happening now with atira or whatever, dude is delusional. avilo is cool because he is the troll train wreck that is fun to laugh at and cheer against, but its one thing to accuse everyoen who beats you of map hacking and stream sniping, its another to think these women love you and then talk about them non stop and harass them and then claim innocence.

i mean this girl called the cops on this guy? this is the sort of creepy ass behavior that can lead to bad things happening in real life, he should go to jail if he crosses any lines
ProTech
Profile Joined November 2010
United States443 Posts
March 19 2019 18:11 GMT
#745
On March 20 2019 02:57 fishjie wrote:
i linked a reddit thread about maria in the previous page:
https://www.reddit.com/r/LivestreamFail/comments/6ql2rv/avilo_goes_through_a_complete_breakdown_on_stream/

he was avilo's "girlfriend" and people were clowning him because she was in europe and they had never met and he got upset and demanded she come online and state that they were in fact dating, of course she didn't, and then he started sobbing hysterically. when asked for any proof that they were "dating" avilo had nothing. apparently all maria did was tweet "<3" and also in chat

i guess similar thing is happening now with atira or whatever, dude is delusional. avilo is cool because he is the troll train wreck that is fun to laugh at and cheer against, but its one thing to accuse everyoen who beats you of map hacking and stream sniping, its another to think these women love you and then talk about them non stop and harass them and then claim innocence.

i mean this girl called the cops on this guy? this is the sort of creepy ass behavior that can lead to bad things happening in real life, he should go to jail if he crosses any lines



You make some valid points, however if you think even for a remote second that Avilo doesn't get sniped for the vast majority of his games you are delusional.

Yes, he throws wood on the fire just like any other streamer who accuses people of stream cheating or map hacking, it doesn't change the fact that it does happen and if the game developers of SC2 acted anything like any other gaming company on twitch action would be taken and you would soon realize that he isn't just making accusation about stream cheating or map hacking.
Kevin_Sorbo
Profile Joined November 2011
Canada3217 Posts
Last Edited: 2019-03-19 19:58:46
March 19 2019 19:58 GMT
#746
On March 20 2019 03:11 ProTech wrote:
Show nested quote +
On March 20 2019 02:57 fishjie wrote:
i linked a reddit thread about maria in the previous page:
https://www.reddit.com/r/LivestreamFail/comments/6ql2rv/avilo_goes_through_a_complete_breakdown_on_stream/

he was avilo's "girlfriend" and people were clowning him because she was in europe and they had never met and he got upset and demanded she come online and state that they were in fact dating, of course she didn't, and then he started sobbing hysterically. when asked for any proof that they were "dating" avilo had nothing. apparently all maria did was tweet "<3" and also in chat

i guess similar thing is happening now with atira or whatever, dude is delusional. avilo is cool because he is the troll train wreck that is fun to laugh at and cheer against, but its one thing to accuse everyoen who beats you of map hacking and stream sniping, its another to think these women love you and then talk about them non stop and harass them and then claim innocence.

i mean this girl called the cops on this guy? this is the sort of creepy ass behavior that can lead to bad things happening in real life, he should go to jail if he crosses any lines



You make some valid points, however if you think even for a remote second that Avilo doesn't get sniped for the vast majority of his games you are delusional.

Yes, he throws wood on the fire just like any other streamer who accuses people of stream cheating or map hacking, it doesn't change the fact that it does happen and if the game developers of SC2 acted anything like any other gaming company on twitch action would be taken and you would soon realize that he isn't just making accusation about stream cheating or map hacking.

getting sniped by trolls on battlenet because you never took any measures to avoid it for 9 years doens't mean you can harass females over the internet. avilo is not a victim.
The mind is like a parachute, it doesnt work unless its open. - Zappa
uiotui
Profile Joined February 2010
United States54 Posts
March 19 2019 21:01 GMT
#747
atira and avilo are both victims in the ongoing drama of the e-sport -uh- world of 'don't talk during games guys'
fishjie
Profile Blog Joined September 2010
United States1519 Posts
March 19 2019 23:36 GMT
#748
On March 20 2019 03:11 ProTech wrote:
Show nested quote +
On March 20 2019 02:57 fishjie wrote:
i linked a reddit thread about maria in the previous page:
https://www.reddit.com/r/LivestreamFail/comments/6ql2rv/avilo_goes_through_a_complete_breakdown_on_stream/

he was avilo's "girlfriend" and people were clowning him because she was in europe and they had never met and he got upset and demanded she come online and state that they were in fact dating, of course she didn't, and then he started sobbing hysterically. when asked for any proof that they were "dating" avilo had nothing. apparently all maria did was tweet "<3" and also in chat

i guess similar thing is happening now with atira or whatever, dude is delusional. avilo is cool because he is the troll train wreck that is fun to laugh at and cheer against, but its one thing to accuse everyoen who beats you of map hacking and stream sniping, its another to think these women love you and then talk about them non stop and harass them and then claim innocence.

i mean this girl called the cops on this guy? this is the sort of creepy ass behavior that can lead to bad things happening in real life, he should go to jail if he crosses any lines



You make some valid points, however if you think even for a remote second that Avilo doesn't get sniped for the vast majority of his games you are delusional.

Yes, he throws wood on the fire just like any other streamer who accuses people of stream cheating or map hacking, it doesn't change the fact that it does happen and if the game developers of SC2 acted anything like any other gaming company on twitch action would be taken and you would soon realize that he isn't just making accusation about stream cheating or map hacking.


avilo accuses everyone of hacking stream sniping as soon as he loses. a clock is right twice per day, irrelevant. point is, guy is delusional. avilo now pretending that he and atira are cool is also that - delusional. avilo pretending he had a girlfriend named maria is also that, delusional. the rage and sniping accusations when he lost was funny and entertaining, and so are watching videos of people stomping avilo, but him harassing women? grossssss

found this youtube video of avilo harassing atira

just really pathetic. but in avilo's mind, she is still cool with him. yeah ok no


blunderfulguy
Profile Blog Joined April 2016
United States1415 Posts
March 20 2019 01:34 GMT
#749
It was already shut down, but I'll tell people to stuff it with trying to make him the victim again anyway. Fuck off with all of that garbage.
Blunder Man doing everything thing a blunder can.
uiotui
Profile Joined February 2010
United States54 Posts
March 20 2019 01:38 GMT
#750
rename thread to avilo/atira fan club imo
ProTech
Profile Joined November 2010
United States443 Posts
March 20 2019 03:43 GMT
#751
On March 20 2019 06:01 uiotui wrote:
atira and avilo are both victims in the ongoing drama of the e-sport -uh- world of 'don't talk during games guys'



Yeah it's getting totally ridiculous that people can't seem to figure out that they're just throwing wood on the fire, and these two are benefiting immensely from it.
Jealous
Profile Blog Joined December 2011
10313 Posts
March 20 2019 04:35 GMT
#752
On March 20 2019 12:43 ProTech wrote:
Show nested quote +
On March 20 2019 06:01 uiotui wrote:
atira and avilo are both victims in the ongoing drama of the e-sport -uh- world of 'don't talk during games guys'



Yeah it's getting totally ridiculous that people can't seem to figure out that they're just throwing wood on the fire, and these two are benefiting immensely from it.

I think that's exactly why they do it.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
bretfart
Profile Joined July 2012
114 Posts
March 20 2019 05:06 GMT
#753
On March 20 2019 13:35 Jealous wrote:
Show nested quote +
On March 20 2019 12:43 ProTech wrote:
On March 20 2019 06:01 uiotui wrote:
atira and avilo are both victims in the ongoing drama of the e-sport -uh- world of 'don't talk during games guys'



Yeah it's getting totally ridiculous that people can't seem to figure out that they're just throwing wood on the fire, and these two are benefiting immensely from it.

I think that's exactly why they do it.


No, it's not. how old are you guys? 15? If you have one active brain cell it should be obvious to you that atira is suffering immensly from this shit... She has two kids. Do you really believe she would let a 31yo unemployed, ruthless, aggressiv momma's boy without any social skills even near her and her kids? A guy who's lost any connection to the real life? A (31yo!!!!) guy who always streams with his door open so his parents can check on him ? (Which they do regularly)

Enough of this defending avilo! He doesnt give a f*** about other human beings. He is abusive and manipulativ. Two days ago he was harassing atira online....again... for hours.. This GIRL HAS TWO KIDS, for god's sake! She called the cops on him! She blocked him everywhere, yet he cant let go!!! And he just cant do all of that in private. NO! He has to put it all online ... Thats what a teenager would do, but not a 31yo adult! It's disgusting (btw: I am 35!)

And one more thing to his starcraft skills / accusations of sniping / cheating: This has guy has been playing sc2 fulltime (!!!!!!) for 8 years and he is stuck at around 5k mmr.... Let ... that.... sink ..... in!!!! If I had spend so much time on sc2 I would be GM for sure (at least on NA, which is relatively easy to do). 8 years of fulltime Sc2. 5k mmr..... Do I have to say more?
Balosaar
Profile Joined August 2012
United States35 Posts
March 20 2019 06:55 GMT
#754
Maryland is one of eleven US states that have two-party, or all-party call recording laws. It's against the law to record someone without their permission.

Maryland. Summary of statute(s): Under Maryland's Wiretapping and Electronic Surveillance Act, it is unlawful to tape record a conversation without the permission of all the parties. Additionally, recording with criminal or tortuous purpose is illegal, regardless of consent.
[yes he lives in Maryland, he has stated on stream several times, for example when he talked about driving to Cheeseadelphia]

Interesting how Avilo admitted on stream to having recorded like every voice conversation he has ever had with Atira, and then he plays some audio on stream.

Showing private messages that can be considered sensitive in nature without any provocation is quite disturbing. What exactly has she done? Banned Avilo from her twitch chat and blocked him on every platform?

No means no. When a girl wants nothing to do with you, you do not have a temper tantrum live on twitch... "Playing Starcraft"... I don't care what chat logs Avilo has, this behavior is unacceptable.


Imagine if some person who is newly interested in Starcraft decides to watch some twitch stream... And the person with the 2nd highest viewers, (was like 600 at one point), is busy harassing some female streamer who normally gets like 20 viewers. Like are we fucking serious right now?

I get that people hate Avilo and his drama... And they don't want to talk about it... But come on dude... He was banned from twitch for a week a month ago for slightly less than this... The same person, no repentance.
2014 WCS Champion StarTale Life ... Best Zerg of Heart of the Swarm
RecklessCraft
Profile Joined February 2015
Canada27 Posts
March 20 2019 07:38 GMT
#755
On March 20 2019 15:55 Balosaar wrote:
Imagine if some person who is newly interested in Starcraft decides to watch some twitch stream... And the person with the 2nd highest viewers, (was like 600 at one point), is busy harassing some female streamer who normally gets like 20 viewers. Like are we fucking serious right now?

Depends on the person, the actual stream didn't constitute harassment imo and was just entertaining watching someone break down live, separate from worrying about his mental fortitude. Definitely stream content that'll hold viewers not everyone is born into this world with a serious face, some people truly don't give a fuck and just soak up the entertainment value.

Also from what it seems, the behind the scenes interaction seems pretty sketch for that poor girl lmao though her claiming to be scared for her safety or something seems a bit of a stretch and she needs to zip back to reality for a sec and just strongly drop the law on him instead of saying "I love you" or whatever here and there, seems super weird.

Someone needs to council Avilo on male-female interactions, normally being yourself is the best advice but for him I think that could be the crux of the issue XD. Doubt he'll seek professional help but who knows maybe he will, but I also doubt a professional could aid in this area because they generally don't help anything other than how to deal with daily life and work and shit that won't get you laid. He should just message someone he knows in private that has femaled a female or two and see if they'd help.
RaccyG
Profile Joined May 2017
14 Posts
March 20 2019 12:24 GMT
#756
I can see why people are annoyed or disturbed by the constant drama, especially if it takes serious forms and involves real-life concerns or harrassment. And I know there are many people who dislike avilo's streaming persona and consider it good news if he is beaten in a game or banned from some platform. You could argue that he deserves it on some grounds and taking a break from the whole thing may even turn out to be a good thing for him. Some also say it's good for the game if the 'toxic person' is gone. As a fan of SC2 I actually think it helps the game/scene/community quite a bit if there are controversial or even antagonistic people around. That's just more interesting and spices things up, like the Nation Wars drama did when people voted for avilo to play. Idra filled that role, too. I don't know if he put on a show for the audience or if he just authentically wanted to be a bit of a ... person towards pretty much everybody but it sure fueled the viewers' interest and caught their attention.

But at an individual level, can we please all remember that avilo is just a person who has feelings? I'm just asking for some civility. Everybody has their shortcomings and insecurities; it doesn't help if you make some of yours public and then feel cornered by everybody. Even if it is fully or partly your own fault for making it so, it's still a tough spot to be in. Image being in his position: Getting a ton of hateful messages from complete strangers, having parts of your private life laid open on twitch of all places (where you would even get ridiculed if you had just cured cancer), being banned from various platforms, feeling like all the fingers in your community are pointing at you. That must sting pretty hard. And everybody in that kind of position naturally feels vulnerable and maybe lashes out all around them. People in that situation should be treated with *more* care instead of less.

And you don't have to become a fan of his to not be a bully. People should have compassion both ways. Of course it's crossing a major line if there's serious real-life stuff involved as with stalking, illegal recording, and threats. That is not a joke and must be taken seriously. It's just also not a joke when you have some several hundred hostile people spam insults and accusations at you every day who publicly share and discuss video footage of your personal low points. Isn't that a kind of harrassment, too? I sure wouldn't particularly enjoy that happen to me. Who knows what kind of stupid shit I might end up saying or doing, especially if I feel like the whole community is watching my every move and has this or that expecation of me. Now, I don't know what his personal situation is really like and I don't want to assume because it's none of our business! But just imagine going through all that IF you already struggle in other walks of life on top of it all. Must be really hard to keep your cool then. I just hope avilo can catch himself. Maybe shrug off the haters (there's always those) and remember that he has a ton of fans and supporters. And I hope he does not feel pressure from the community to do one thing or another so that he does not make any (more?) mistakes that could end up badly hurting him or other people. I definitely think the community shouldn't make it harder for him than it has to be.
DeepElemBlues
Profile Blog Joined January 2011
United States5079 Posts
March 20 2019 15:55 GMT
#757
the people who mess with him so they can see him break down and go crazy on stream are worse than he is imo

but that's like saying bone cancer is worse than lung cancer
no place i'd rather be than the satellite of love
AlgeriaT
Profile Joined April 2010
Sweden2197 Posts
March 20 2019 16:02 GMT
#758
On March 20 2019 21:24 RaccyG wrote:
I can see why people are annoyed or disturbed by the constant drama, especially if it takes serious forms and involves real-life concerns or harrassment. And I know there are many people who dislike avilo's streaming persona and consider it good news if he is beaten in a game or banned from some platform. You could argue that he deserves it on some grounds and taking a break from the whole thing may even turn out to be a good thing for him. Some also say it's good for the game if the 'toxic person' is gone. As a fan of SC2 I actually think it helps the game/scene/community quite a bit if there are controversial or even antagonistic people around. That's just more interesting and spices things up, like the Nation Wars drama did when people voted for avilo to play. Idra filled that role, too. I don't know if he put on a show for the audience or if he just authentically wanted to be a bit of a ... person towards pretty much everybody but it sure fueled the viewers' interest and caught their attention.

But at an individual level, can we please all remember that avilo is just a person who has feelings? I'm just asking for some civility. Everybody has their shortcomings and insecurities; it doesn't help if you make some of yours public and then feel cornered by everybody. Even if it is fully or partly your own fault for making it so, it's still a tough spot to be in. Image being in his position: Getting a ton of hateful messages from complete strangers, having parts of your private life laid open on twitch of all places (where you would even get ridiculed if you had just cured cancer), being banned from various platforms, feeling like all the fingers in your community are pointing at you. That must sting pretty hard. And everybody in that kind of position naturally feels vulnerable and maybe lashes out all around them. People in that situation should be treated with *more* care instead of less.

And you don't have to become a fan of his to not be a bully. People should have compassion both ways. Of course it's crossing a major line if there's serious real-life stuff involved as with stalking, illegal recording, and threats. That is not a joke and must be taken seriously. It's just also not a joke when you have some several hundred hostile people spam insults and accusations at you every day who publicly share and discuss video footage of your personal low points. Isn't that a kind of harrassment, too? I sure wouldn't particularly enjoy that happen to me. Who knows what kind of stupid shit I might end up saying or doing, especially if I feel like the whole community is watching my every move and has this or that expecation of me. Now, I don't know what his personal situation is really like and I don't want to assume because it's none of our business! But just imagine going through all that IF you already struggle in other walks of life on top of it all. Must be really hard to keep your cool then. I just hope avilo can catch himself. Maybe shrug off the haters (there's always those) and remember that he has a ton of fans and supporters. And I hope he does not feel pressure from the community to do one thing or another so that he does not make any (more?) mistakes that could end up badly hurting him or other people. I definitely think the community shouldn't make it harder for him than it has to be.

Avilo has definitely wound up in a vicious cycle where his actions bring more and more hate which in turn makes him behave even worse. At this point the only way out for him is to let it all go, walk away and begin again with something else in life. Which might be possible with help from those who truly know him.

The only other constructive intervention actually possible would be that Twitch ban him once and for all - that may sound like punishment, but continuing streaming really only puts Avilo deeper and deeper in the shit. This has to be obvious for anyone who's been following him over the past few years.

Regardless of outer influence and stress from constant troll attacks etc., he actually is committing serious acts of harassment which will only make things worse for himself. During his last stream he even played private voice mail from Atira and screen captured vid from his Discord conversations with her, live in front of hundreds of viewers. No matter how sorry we should be feeling for him, that shit will still be completely unacceptable, and continues to hurt other people.

He needs to first of all get off Twitch, and leave his position as a public person within the gaming community. Then he can address reconstructing his life. Currently there's just too much inertia from his past years as a "controversial" person, I don't see him overcoming that in any other way.

He's certainly not the only one who bears blame in this situation becoming what it is. But as long as he himself doesn't acknowledge the mistakes he actually has made, and forgives himself as well as asks the forgiveness of those he's damaged, he will never break free from this endless cycle of paranoia and self-centredness. Us having pity on him will do part of the job. But the main effort will have to come from himself.
CORN GIRL + Flash + FanTaSy + CholeraSC + iNcontroL 4 eva <3
Elmonti
Profile Joined July 2018
Spain299 Posts
Last Edited: 2019-03-20 17:10:49
March 20 2019 16:05 GMT
#759
On March 21 2019 00:55 DeepElemBlues wrote:
the people who mess with him so they can see him break down and go crazy on stream are worse than he is imo

but that's like saying bone cancer is worse than lung cancer


Agree. Some people say "His stream is great and he is entertaining, but the harassing stuff is too much..."

In first place, I don't know how the fuck can anyone see his stream as something funny or entertaining... Having said that, he is not a victim of anything but himself, he has been asking for it for years and he deserves whatever happens to him. It's a pity that those mentally 13yo you mentioned don't receive their punishment too.
bretfart
Profile Joined July 2012
114 Posts
March 20 2019 16:20 GMT
#760
Twitch has to ban him for life... That way he might find a way back into society. With a proper job. A place of his own. Maybe even a gf some day (assuming he will be able to develop the social skills required).
RaccyG
Profile Joined May 2017
14 Posts
March 20 2019 17:14 GMT
#761
Avilo has definitely wound up in a vicious cycle where his actions bring more and more hate which in turn makes him behave even worse. At this point the only way out for him is to let it all go, walk away and begin again with something else in life. Which might be possible with help from those who truly know him.

The only other constructive intervention actually possible would be that Twitch ban him once and for all - that may sound like punishment, but continuing streaming really only puts Avilo deeper and deeper in the shit. This has to be obvious for anyone who's been following him over the past few years.

Regardless of outer influence and stress from constant troll attacks etc., he actually is committing serious acts of harassment which will only make things worse for himself. During his last stream he even played private voice mail from Atira and screen captured vid from his Discord conversations with her, live in front of hundreds of viewers. No matter how sorry we should be feeling for him, that shit will still be completely unacceptable, and continues to hurt other people.

He needs to first of all get off Twitch, and leave his position as a public person within the gaming community. Then he can address reconstructing his life. Currently there's just too much inertia from his past years as a "controversial" person, I don't see him overcoming that in any other way.

He's certainly not the only one who bears blame in this situation becoming what it is. But as long as he himself doesn't acknowledge the mistakes he actually has made, and forgives himself as well as asks the forgiveness of those he's damaged, he will never break free from this endless cycle of paranoia and self-centredness. Us having pity on him will do part of the job. But the main effort will have to come from himself.


Completely agree with all you're saying. My main point is that the antisocial and sensationalist behavior of some people who are constantly poking him to make fun of his dire situation isn't helping. It makes me a bit angry at them because if they were honest they'd at least admit to their entertainment at his expense since he's become an easy target to dislike in some parts of this community. And that's just disgusting when a bunch of merciless cowards keep kicking and prodding somebody who's already lying on the floor. This is as close as the sc2 community gets to a lynching mob and I don't appreciate our community like this. If you like avilo or not, he clearly deserves better than that. If you want to help him, be kind. If you don't want to be kind, at least ignore the man. If everybody did that, there'd be only people left who can help lift him up to the point where he's gonna be able to help himself better and he would probably have a way easier time stopping that "vicious cycle" stuff that you referred to. Of course his decisions and their consequences are still his responsibility. Still, people can either take a supportive or at least indifferent stance towards him or undermine any kind of development for the better because they're hateful, trolling, baiting, w/e. Unfortunately there's a ton of people who think it's cool to hate on avilo (I know a few of them..) and some are making weird excuses to try and justify their behavior which I find hypocritical. That this attitude of "let's all hate on that one guy" is relatively widespread and surprisingly well-accepted in this community is something that we do have control over and that I argue we should change. Because that's just basic decency and everybody deserves that much when things get serious. And yeah, as much as I enjoyed his sc2 stream when it was about playing the game and accusing people of maphacks it's probably in everybody's best interest if he gave it a permanent or at least prolonged rest until things have changed.
fishjie
Profile Blog Joined September 2010
United States1519 Posts
March 20 2019 19:45 GMT
#762
avilo isn't a victim, he's the one that lashes out angrily out at everyone spewing insults and hacking accusations every time he loses, spam harasses females and apparently thinks these said females are his girlfriend, and in general behaves like an ass. so if people crap on him, its cause he brought it on himself. now i agree that avilo is awesome because the "heel" in wrestling is a vital role that brings views to a game, and avilo is a great heel. except it turns out he's not acting, he actually is harassing women, and then his clueless fans like some of the people int his thread think he's innocent and that these women are actually interested in him LOL

avilo is the poor man's idra, except idra was actually successful, has lots more money, doesn't live at home with mom, and doesn't molest women online, and not a virgin
ProTech
Profile Joined November 2010
United States443 Posts
March 21 2019 05:02 GMT
#763
On March 20 2019 14:06 bretfart wrote:
Show nested quote +
On March 20 2019 13:35 Jealous wrote:
On March 20 2019 12:43 ProTech wrote:
On March 20 2019 06:01 uiotui wrote:
atira and avilo are both victims in the ongoing drama of the e-sport -uh- world of 'don't talk during games guys'



Yeah it's getting totally ridiculous that people can't seem to figure out that they're just throwing wood on the fire, and these two are benefiting immensely from it.

I think that's exactly why they do it.


No, it's not. how old are you guys? 15? If you have one active brain cell it should be obvious to you that atira is suffering immensly from this shit... She has two kids. Do you really believe she would let a 31yo unemployed, ruthless, aggressiv momma's boy without any social skills even near her and her kids? A guy who's lost any connection to the real life? A (31yo!!!!) guy who always streams with his door open so his parents can check on him ? (Which they do regularly)

Enough of this defending avilo! He doesnt give a f*** about other human beings. He is abusive and manipulativ. Two days ago he was harassing atira online....again... for hours.. This GIRL HAS TWO KIDS, for god's sake! She called the cops on him! She blocked him everywhere, yet he cant let go!!! And he just cant do all of that in private. NO! He has to put it all online ... Thats what a teenager would do, but not a 31yo adult! It's disgusting (btw: I am 35!)

And one more thing to his starcraft skills / accusations of sniping / cheating: This has guy has been playing sc2 fulltime (!!!!!!) for 8 years and he is stuck at around 5k mmr.... Let ... that.... sink ..... in!!!! If I had spend so much time on sc2 I would be GM for sure (at least on NA, which is relatively easy to do). 8 years of fulltime Sc2. 5k mmr..... Do I have to say more?



If it meant an extra fluid income from a twitch stream, yes i'm sure she wouldn't at all be unhappy about.

But this is the kind of shit I am talking about, you're just making the problem worse buying into this drama.
RaccyG
Profile Joined May 2017
14 Posts
March 21 2019 09:08 GMT
#764
avilo isn't a victim, he's the one that lashes out angrily out at everyone spewing insults and hacking accusations every time he loses, spam harasses females and apparently thinks these said females are his girlfriend, and in general behaves like an ass. so if people crap on him, its cause he brought it on himself.


He may have made some decisions that people think are bad, including (at a more harmless level) building a stream around the concept of being a whining, flaming, accusing-people-of-hacking mech terran. If you've been playing that role forever like he has then people expect you to consistently behave that way and people tend to fulfil that kind of social expectation, especially because the other people try to actively push them in that role. It's hard to get out of there. And as for the insulting, that's part of what this perceived role now entails. Obviously whoever gets insulted is not gonna like it and some may fire back, perpetuating this kind of destructive exchange. If there's hundreds of viewers at the side who think it's fun and games and spur this kind of behavior further on then that's an exacerbating factor and avilo is definitely a victim of that. It's not like you can't be the culprit in one regard and a victim in another.

Yes, he should stop harrassing and threatening women (or anybody else for that matter) at once. And the community should stop being a pack of hysterical hyenas forming an audience in front of which he feels an expectation to perform. Under that kind of pressure people can get desperate and do even more stupid stuff. It's not helping him or anybody else, the only thing it's good for is for some selfish entertainment. And I don't think it's entertaining seeing people suffer like that.

uiotui
Profile Joined February 2010
United States54 Posts
March 24 2019 02:46 GMT
#765
so have they wed or at least has avilo got married yet or what -lol-

User was temp banned for this post.
SoupedUpHellion
Profile Joined January 2019
20 Posts
April 02 2019 18:42 GMT
#766
Yo, y'all need to add Avilo back to the sidebar....stop being petty.
bretfart
Profile Joined July 2012
114 Posts
April 04 2019 09:35 GMT
#767
You mean that guy who said "people like you need to end themselves" on stream two days ago?
PinoKotsBeer
Profile Joined February 2014
Netherlands1385 Posts
April 04 2019 15:32 GMT
#768
On April 03 2019 03:42 SoupedUpHellion wrote:
Yo, y'all need to add Avilo back to the sidebar....stop being petty.

It has nothing to do with being petty. Its action=reaction, his behaviour caused the removal of his stream, not the otherway around. Im suprised that they even let this topic open...
http://www.twitch.tv/pinokotsbeer
WombaT
Profile Blog Joined May 2010
Northern Ireland26622 Posts
April 04 2019 17:36 GMT
#769
I used to watch Avilo, really regularly for a period. I enjoyed the heel persona he had, but also he did legitimately play a different style of Terran to most other stuff that I could watch. I was in a pretty bad place at the time, and avilo's 'fuck the world' attitude dovetailed with that considerably.

It appears checking him out recently that this is worse, without excusing what he himself does he's trapped in a loop of negativity where his whining is the draw, maybe he's playing a character, maybe or not and then his audience comes just for that and he's stuck doing it so that it brings the worst out of him.

You see it pretty regularly in folks who form an audience for 'anti SJW' content whereupon it starts attracting people who aren't just there to laugh or get annoyed at the excesses of that group, but more and more people who straight up just don't like certain groups of people. Then said content creator makes a video that goes against the general views of the second group and they go mental (say when some guy Thunderfoot made a video that was pro EU)

I don't know the guy obviously, but I wouldn't really want to be stuck in a loop like that. If I was Grubby, where he's super nice and positive to a fault and his audience usually reflect this, hitting that 'stream now' button would be something I'd look forward to and I'd get to experience the best side of being a public figure in that sense.

Avilo, through his own fault and that of others as well, I'd be bloody dreading hitting that button for another session. I'm with RaccyG in that taking at least a break would probably be the best thing for the guy's headspace right now

'You'll always be the cuddly marsupial of my heart, despite the inherent flaws of your ancestry' - Squat
Jealous
Profile Blog Joined December 2011
10313 Posts
April 04 2019 17:41 GMT
#770
On April 05 2019 02:36 Wombat_NI wrote:
I used to watch Avilo, really regularly for a period. I enjoyed the heel persona he had, but also he did legitimately play a different style of Terran to most other stuff that I could watch. I was in a pretty bad place at the time, and avilo's 'fuck the world' attitude dovetailed with that considerably.

It appears checking him out recently that this is worse, without excusing what he himself does he's trapped in a loop of negativity where his whining is the draw, maybe he's playing a character, maybe or not and then his audience comes just for that and he's stuck doing it so that it brings the worst out of him.

You see it pretty regularly in folks who form an audience for 'anti SJW' content whereupon it starts attracting people who aren't just there to laugh or get annoyed at the excesses of that group, but more and more people who straight up just don't like certain groups of people. Then said content creator makes a video that goes against the general views of the second group and they go mental (say when some guy Thunderfoot made a video that was pro EU)

I don't know the guy obviously, but I wouldn't really want to be stuck in a loop like that. If I was Grubby, where he's super nice and positive to a fault and his audience usually reflect this, hitting that 'stream now' button would be something I'd look forward to and I'd get to experience the best side of being a public figure in that sense.

Avilo, through his own fault and that of others as well, I'd be bloody dreading hitting that button for another session. I'm with RaccyG in that taking at least a break would probably be the best thing for the guy's headspace right now


This isn't really a chicken or egg scenario. Avilo was a shitter, and this attracted a particular audience. It's not an act, he has always been this way.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
ProTech
Profile Joined November 2010
United States443 Posts
April 04 2019 19:07 GMT
#771
I genuinely don't understand why you guys are on about the topic of " what kind of person he is "

Why does that matter? If you don't like the stream, ignore it and move on to the next.

The whole idea that someone has to be a decent human being makes absolutely no sense when it comes to twitch. refer to tyler 1
StabiloBoss20
Profile Joined July 2015
313 Posts
April 05 2019 10:18 GMT
#772
i tend to agree.

… as long as i don’t tune in CNN and see him going into a school with a gun. then it will be all „we should have known“.
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2019-04-05 15:18:46
April 05 2019 15:17 GMT
#773
On April 05 2019 19:18 StabiloBoss20 wrote:
i tend to agree.

… as long as i don’t tune in CNN and see him going into a school with a gun. then it will be all „we should have known“.

Almost all of these kinds of shootings are performed by boys/men growing up in father-less homes. He gets his "violence catharsis experience" by playing video games. If anything, Video Games make people less violent.. not more violent.

Based on my studies of these kinds of shootings and serial murderers such as Ted Bundy, Bruce Maccarthur, and Aileen Wournos I'd say the probability of Avilo becoming a mass murderer is very close to zero.

i think Avilo needs his own theme song. I propose "Don't Stand So Close To Me" by The Police.

TL; DR : don't worry man: Avilo gets off on winning RTS games not physically injuring real-people in the real-world.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
fishjie
Profile Blog Joined September 2010
United States1519 Posts
April 05 2019 18:30 GMT
#774
yeah right avilo would be a poster child for the "incel" movement. angry, entitled toward women he has never even met in real life, most likely never been with a woman in his entire life, blames all his problems on everyone else. the only thing he has going for him is his stream revenue. if he got banned from stream, he would be unemployed and is basically completely unemployable. i sure as hell wouldn't want him on my team. nobody wants toxic people who stalk women on their teams. so he would totally fit the profile of an incel shooter
WombaT
Profile Blog Joined May 2010
Northern Ireland26622 Posts
April 05 2019 22:57 GMT
#775
On April 05 2019 04:07 ProTech wrote:
I genuinely don't understand why you guys are on about the topic of " what kind of person he is "

Why does that matter? If you don't like the stream, ignore it and move on to the next.

The whole idea that someone has to be a decent human being makes absolutely no sense when it comes to twitch. refer to tyler 1

Maybe. Personally I used to watch his stream years and years ago, I only recently reinstalled Twitch so I could watch Grubby on my stream, figured I’d check what some of my old followed streams.

Go to avilo’s and I’m confronted with some drama that I’m completely unaware of and a dude who is obviously distressed about it. Came to this thread out of curiosity to fill in those gaps.

I enjoyed some of the whining, not going to lie about that. I also enjoyed that he stubbornly eschewed conventional wisdom and strats and tried to make his own stubborn desire to make mech work. As an extremely fucking stubborn person myself in pursuing what I think ‘should’ work, I genuinely admired that facet of his approach to an RTS where far too many players just copy convention and sidestep any kind of strategic exploration whatsoever.

I don’t hate the guy at all, I don’t even think he’s necessarily a horrible human at heart or anything like that either. I don’t think being locked into a job that requires you to be toxic, for an audience that want that and are themselves toxic is good for the guy over a sustained period.

Whatever, it’s just my two irrelevant cents, I think the guy needs a break from that loop and it will benefit him mentally, others are free to disagree.

Why shouldn’t being a decent human being come in to it anyway? Having an extremely toxic persona on Twitch maybe, ideally not. If that starts to rope in other people into harassment and other such things then how is that acceptable?
'You'll always be the cuddly marsupial of my heart, despite the inherent flaws of your ancestry' - Squat
ProTech
Profile Joined November 2010
United States443 Posts
April 06 2019 01:43 GMT
#776
On April 06 2019 07:57 Wombat_NI wrote:
Show nested quote +
On April 05 2019 04:07 ProTech wrote:
I genuinely don't understand why you guys are on about the topic of " what kind of person he is "

Why does that matter? If you don't like the stream, ignore it and move on to the next.

The whole idea that someone has to be a decent human being makes absolutely no sense when it comes to twitch. refer to tyler 1

Maybe. Personally I used to watch his stream years and years ago, I only recently reinstalled Twitch so I could watch Grubby on my stream, figured I’d check what some of my old followed streams.

Go to avilo’s and I’m confronted with some drama that I’m completely unaware of and a dude who is obviously distressed about it. Came to this thread out of curiosity to fill in those gaps.

I enjoyed some of the whining, not going to lie about that. I also enjoyed that he stubbornly eschewed conventional wisdom and strats and tried to make his own stubborn desire to make mech work. As an extremely fucking stubborn person myself in pursuing what I think ‘should’ work, I genuinely admired that facet of his approach to an RTS where far too many players just copy convention and sidestep any kind of strategic exploration whatsoever.

I don’t hate the guy at all, I don’t even think he’s necessarily a horrible human at heart or anything like that either. I don’t think being locked into a job that requires you to be toxic, for an audience that want that and are themselves toxic is good for the guy over a sustained period.

Whatever, it’s just my two irrelevant cents, I think the guy needs a break from that loop and it will benefit him mentally, others are free to disagree.

Why shouldn’t being a decent human being come in to it anyway? Having an extremely toxic persona on Twitch maybe, ideally not. If that starts to rope in other people into harassment and other such things then how is that acceptable?



What people don't understand is that streams get boring in starcraft 2. Everyone is trying to do the same thing as the next and no one is genuinely entertaining.

It's all game commentary and the game itself, this is why avilo has viewers, this is why I do well on my stream.

We give people a different perspective, and that's what starcraft needs to not be in the dumpster when it comes to viewership on twitch.

Now that avilo is gone from TL that drama will no longer be in spotlight and thus killing the overall viewership at a time where starcraft needs all the viewership it can get, GOOD OR NOT.
fishjie
Profile Blog Joined September 2010
United States1519 Posts
April 06 2019 06:36 GMT
#777


lol he still can't get the hint. WHY AM I BANNED IN HER CHAT STILL??? he still thinks its the mods and that she wants anything to do with him looooool even after she reported to police

just wow. cept that stalking is not funny. he should be jailed if he keeps up the harassment or tries to harass irl
Valikyr
Profile Joined June 2010
Sweden2653 Posts
Last Edited: 2019-04-06 10:48:17
April 06 2019 08:49 GMT
#778
On April 06 2019 15:36 fishjie wrote:
https://www.youtube.com/watch?v=TSmHC4Kuc5Y

lol he still can't get the hint. WHY AM I BANNED IN HER CHAT STILL??? he still thinks its the mods and that she wants anything to do with him looooool even after she reported to police

just wow. cept that stalking is not funny. he should be jailed if he keeps up the harassment or tries to harass irl

Just watched a bit of it but he does seem pretty delusional. How does he not get it?
WombaT
Profile Blog Joined May 2010
Northern Ireland26622 Posts
April 06 2019 14:34 GMT
#779
On April 06 2019 10:43 ProTech wrote:
Show nested quote +
On April 06 2019 07:57 Wombat_NI wrote:
On April 05 2019 04:07 ProTech wrote:
I genuinely don't understand why you guys are on about the topic of " what kind of person he is "

Why does that matter? If you don't like the stream, ignore it and move on to the next.

The whole idea that someone has to be a decent human being makes absolutely no sense when it comes to twitch. refer to tyler 1

Maybe. Personally I used to watch his stream years and years ago, I only recently reinstalled Twitch so I could watch Grubby on my stream, figured I’d check what some of my old followed streams.

Go to avilo’s and I’m confronted with some drama that I’m completely unaware of and a dude who is obviously distressed about it. Came to this thread out of curiosity to fill in those gaps.

I enjoyed some of the whining, not going to lie about that. I also enjoyed that he stubbornly eschewed conventional wisdom and strats and tried to make his own stubborn desire to make mech work. As an extremely fucking stubborn person myself in pursuing what I think ‘should’ work, I genuinely admired that facet of his approach to an RTS where far too many players just copy convention and sidestep any kind of strategic exploration whatsoever.

I don’t hate the guy at all, I don’t even think he’s necessarily a horrible human at heart or anything like that either. I don’t think being locked into a job that requires you to be toxic, for an audience that want that and are themselves toxic is good for the guy over a sustained period.

Whatever, it’s just my two irrelevant cents, I think the guy needs a break from that loop and it will benefit him mentally, others are free to disagree.

Why shouldn’t being a decent human being come in to it anyway? Having an extremely toxic persona on Twitch maybe, ideally not. If that starts to rope in other people into harassment and other such things then how is that acceptable?



What people don't understand is that streams get boring in starcraft 2. Everyone is trying to do the same thing as the next and no one is genuinely entertaining.

It's all game commentary and the game itself, this is why avilo has viewers, this is why I do well on my stream.

We give people a different perspective, and that's what starcraft needs to not be in the dumpster when it comes to viewership on twitch.

Now that avilo is gone from TL that drama will no longer be in spotlight and thus killing the overall viewership at a time where starcraft needs all the viewership it can get, GOOD OR NOT.

Starcraft is Starcraft, is it worth keeping alive if it needs such drama to do it?

I do agree with your point, variety is the spice of life after all and especially as many still stream without even a bit of commentary it can get very samey.

The Idra era was great as his foibles were a great counterpoint to many of the conventions of most other notable players at the time. I’m watching WC3 again lately and ToD has some great meltdowns on balance on the regular.

Both of these guys kept most of that purely to the games itself and contributed to the community in various different ways as well. Neither did certain things that avilo does, especially lately.

TL has way stricter moderation standards than most comparable communities, and thus I find is one of the better ones out there, especially the forums.

I’m not even sure how much traffic they’d redirect to scilo’s stream anyway.

On the inverse side, what if someone checks out SC2 for the first time on Twitch and is put off the game entirely? A pure hypothetical but drama isn’t always going to be a net gain for a community as some people actively avoid drama and negativity
'You'll always be the cuddly marsupial of my heart, despite the inherent flaws of your ancestry' - Squat
bretfart
Profile Joined July 2012
114 Posts
April 06 2019 17:39 GMT
#780
avilo's twitter is gone
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2019-04-09 17:56:08
April 09 2019 17:42 GMT
#781
On April 06 2019 03:30 fishjie wrote: he would be unemployed and is basically completely unemployable. i sure as hell wouldn't want him on my team. nobody wants toxic people who stalk women on their teams.

She is in London, Ontario, Canada. He is someplace in the carolinas. i think she'll be ok.

I was at an autograph signing for a big boxing event/show a few years ago. It featured 2-time convicted murderer Don King and 1-time convicted rapist Mike Tyson. Everything went fine. Every one on staff at the event had no problem working with King and Tyson.

So ,ya, i think you're being a bit overly dramatic here guy. I'm sure plenty of people who need the money in whatever job they are working in .... will find a way to work with Avilo.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
Elmonti
Profile Joined July 2018
Spain299 Posts
April 09 2019 18:24 GMT
#782
On April 10 2019 02:42 JimmyJRaynor wrote:
Show nested quote +
On April 06 2019 03:30 fishjie wrote: he would be unemployed and is basically completely unemployable. i sure as hell wouldn't want him on my team. nobody wants toxic people who stalk women on their teams.

She is in London, Ontario, Canada. He is someplace in the carolinas. i think she'll be ok.

I was at an autograph signing for a big boxing event/show a few years ago. It featured 2-time convicted murderer Don King and 1-time convicted rapist Mike Tyson. Everything went fine. Every one on staff at the event had no problem working with King and Tyson.

So ,ya, i think you're being a bit overly dramatic here guy. I'm sure plenty of people who need the money in whatever job they are working in .... will find a way to work with Avilo.


Mmmhm both of them behaving normal at that event means they wouldn't cause problems working for months/years in an office or in a restaurant surrounded by coworkers and customers, I'm sure you would love to have them working next to you....... yep, nice parallel dude.....
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
April 09 2019 19:10 GMT
#783
When people need money they'll tolerate and try to work within a less than ideal situation. I take on disaster projects all the time.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
Kevin_Sorbo
Profile Joined November 2011
Canada3217 Posts
April 09 2019 19:30 GMT
#784
Yes the fact that avilo has made 0 friends but countless enemies over his streaming career clearly shows his potential as a team player.

Your personal experience is totally irrelevent to the subject imo.
The mind is like a parachute, it doesnt work unless its open. - Zappa
MockHamill
Profile Joined March 2010
Sweden1798 Posts
April 10 2019 06:41 GMT
#785
I think it is awsome that Avilo is streaming again. I do not care about the drama, I just want an enterataining mech stream. Most streamers are quite boring so having streamers that actually are entertaining is a good thing.
SoupedUpHellion
Profile Joined January 2019
20 Posts
April 10 2019 13:14 GMT
#786
She is in London, Ontario, Canada. He is someplace in the carolinas.


TIL Maryland is in the Carolinas, LULLLL. Guess I'll start referring to myself as a North Carolinian then, I've always admired their state.
Jealous
Profile Blog Joined December 2011
10313 Posts
April 10 2019 16:04 GMT
#787
On April 10 2019 22:14 SoupedUpHellion wrote:
Show nested quote +
She is in London, Ontario, Canada. He is someplace in the carolinas.


TIL Maryland is in the Carolinas, LULLLL. Guess I'll start referring to myself as a North Carolinian then, I've always admired their state.

I can see why some of these people are Avilo fans now.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
JimmyJRaynor
Profile Blog Joined April 2010
Canada17467 Posts
Last Edited: 2019-04-10 18:36:40
April 10 2019 18:17 GMT
#788
On April 10 2019 04:30 Kevin_Sorbo wrote:
Yes the fact that avilo has made 0 friends but countless enemies over his streaming career clearly shows his potential as a team player.

Your personal experience is totally irrelevent to the subject imo.

Only if you context drop. The poster stated Avilo will be unemployable. No qualification... just that vague generalization. this generalization invites any person's experiences into the convo.

Had the poster made a more realistic, delimited comment like .. it'll take a year for him to get a job if he loses his twitch money. but, he didn't.

I've seen people with far more going against them ... get jobs. The local newspaper delivery guy has schizophrenia. He still has a job. 2 jobs in fact. He also works for a roofer.

Seeing as you brought up personal experience I'll add this: I wonder about the amount of life experience people have who are certain Avilo is a permanent write-off. I think its well within the realm of possibility that Avilo can get a job and evolve into an employable person if he isn't right now.
On April 10 2019 22:14 SoupedUpHellion wrote:
Show nested quote +
She is in London, Ontario, Canada. He is someplace in the carolinas.

TIL Maryland is in the Carolinas, LULLLL. Guess I'll start referring to myself as a North Carolinian then, I've always admired their state.

maryland eh? what's that? about a 10 hour drive from London? which then leads back to my point. I think she is safe.
Ray Kassar To David Crane : "you're no more important to Atari than the factory workers assembling the cartridges"
operwolf
Profile Joined April 2008
United States324 Posts
April 10 2019 18:56 GMT
#789
maryland eh? what's that? about a 10 hour drive from London? which then leads back to my point. I think she is safe.


Because he didn't fly to Europe to stalk another girl who ended up calling the police on him, right? Or the fact that this new girl has called the cops on him multiple times and they have visited his home telling him to leave her alone, because she herself has said avilo scares her? Hmm, doesn't seem like she feels safe.
He'll end up dead, because he'll die.
WombaT
Profile Blog Joined May 2010
Northern Ireland26622 Posts
April 10 2019 22:43 GMT
#790
Why is it so complicated to call out bloody stupid behaviour?

It doesn’t really matter if she plausibly feels safe or not, or there’s no real legitimate threat to her. Avilo and subsequently his fans could harass me and I’d feel zero threat whatsoever, I’d feel extremely irritated that I couldn’t go about my online business in peace.

‘He’s entertaining’. So is watching the cartels behaving people to some folks.

He isn’t less entertaining without this either, he’s more so. As I said before I used to watch his stream a lot, cartoonish balance whine plus playing his own particular style that is legitimately his own, yeah I’ll watch that. He commentates his own games better than most, he interacts and cultivated a fanbase better than many other streamers. I find him pretty funny when he’s being self aware.

He has a lot going for him in those ways. Do that?

His stream is actually good in many ways, shed accusing players of maphacking baselessly and shed this ridiculous personal drama of his and it’s just a better stream, and way less toxic.

I tuned in, again the other day to watch some Avilo and it’s him addressing this whole recent farrago, which is just incredibly boring for a start, and also actively distasteful.

‘I’m a fan but he needs to be able to be as toxic as he and his fanbase wants because that’s what draws viewers’ is simultaneously a carte blanche for the scene’s image to not matter whatsoever, but also shows no faith in avilo himself to prosper on his gameplay and personality alone.

'You'll always be the cuddly marsupial of my heart, despite the inherent flaws of your ancestry' - Squat
Kevin_Sorbo
Profile Joined November 2011
Canada3217 Posts
April 14 2019 13:14 GMT
#791
To all the avilo apologists, know that he has a court date scheduled in june for his electronic harassment case...
Seems like even if Twitch doesn't do anything there will be repercussions.
The mind is like a parachute, it doesnt work unless its open. - Zappa
AlgeriaT
Profile Joined April 2010
Sweden2197 Posts
April 14 2019 15:38 GMT
#792
On April 14 2019 22:14 Kevin_Sorbo wrote:
To all the avilo apologists, know that he has a court date scheduled in june for his electronic harassment case...
Seems like even if Twitch doesn't do anything there will be repercussions.

But now they finally did.

www.twitch.tv/avilo

It's over.
CORN GIRL + Flash + FanTaSy + CholeraSC + iNcontroL 4 eva <3
Jealous
Profile Blog Joined December 2011
10313 Posts
Last Edited: 2019-04-14 15:40:23
April 14 2019 15:39 GMT
#793
On April 15 2019 00:38 AlgeriaT wrote:
Show nested quote +
On April 14 2019 22:14 Kevin_Sorbo wrote:
To all the avilo apologists, know that he has a court date scheduled in june for his electronic harassment case...
Seems like even if Twitch doesn't do anything there will be repercussions.

But now they finally did.

www.twitch.tv/avilo

It's over.

Fuck yes. Justice boner full mast and through the roof right now.
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
KappaKingPrime
Profile Joined May 2014
United States468 Posts
April 14 2019 16:22 GMT
#794
Apparently he is also being sued with 2 charges, it's lights out for him.
Jealous
Profile Blog Joined December 2011
10313 Posts
April 14 2019 16:26 GMT
#795
On April 15 2019 01:22 KappaKingPrime wrote:
Apparently he is also being sued with 2 charges, it's lights out for him.

Sued by whom? What charges?
"The right to vote is only the oar of the slaveship, I wanna be free." -- бум бум сучка!
KappaKingPrime
Profile Joined May 2014
United States468 Posts
April 14 2019 16:40 GMT
#796
By streamer Atira, the charges are "Email Harassment" and "Recording Conversations without Consent".
uiotui
Profile Joined February 2010
United States54 Posts
April 14 2019 16:45 GMT
#797
i wonder if jef bezos intentionally pulled it to coincide with the gsl finals... trying to save face or whatever
DreamlnCode
Profile Joined December 2018
United Kingdom77 Posts
April 14 2019 17:02 GMT
#798
On April 15 2019 01:40 KappaKingPrime wrote:
By streamer Atira, the charges are "Email Harassment" and "Recording Conversations without Consent".


Technical terms.
uiotui
Profile Joined February 2010
United States54 Posts
April 14 2019 17:25 GMT
#799
this is like the paris hilton or kim kardashian stuff x a lot
SPcrusader
Profile Joined September 2011
Norway99 Posts
April 14 2019 20:27 GMT
#800
On April 15 2019 00:38 AlgeriaT wrote:
Show nested quote +
On April 14 2019 22:14 Kevin_Sorbo wrote:
To all the avilo apologists, know that he has a court date scheduled in june for his electronic harassment case...
Seems like even if Twitch doesn't do anything there will be repercussions.

But now they finally did.

www.twitch.tv/avilo

It's over.


Darn it that sucks. I get a feeling there was some major conspiracy behind the scenes to pull this off. If you watch his Tennis Vods you might change your mind about him.
https://www.twitch.tv/spcrusader
DarkPlasmaBall
Profile Blog Joined March 2010
United States45586 Posts
April 14 2019 20:52 GMT
#801
On April 15 2019 05:27 SPcrusader wrote:
Show nested quote +
On April 15 2019 00:38 AlgeriaT wrote:
On April 14 2019 22:14 Kevin_Sorbo wrote:
To all the avilo apologists, know that he has a court date scheduled in june for his electronic harassment case...
Seems like even if Twitch doesn't do anything there will be repercussions.

But now they finally did.

www.twitch.tv/avilo

It's over.


Darn it that sucks. I get a feeling there was some major conspiracy behind the scenes to pull this off. If you watch his Tennis Vods you might change your mind about him.


To pull what off? All you need to do is watch his stream to see that there are way too many instances of him being super toxic and harassing... and according to Redditors who have looked up case files, this isn't even his first time Avilo is going to court. https://www.reddit.com/r/starcraft/comments/bd3ynr/avilo_banned_again_for_harassing_female_streamer/

Just let him fade away into a meme.
"There is nothing more satisfying than looking at a crowd of people and helping them get what I love." ~Day[9] Daily #100
phodacbiet
Profile Joined August 2010
United States1740 Posts
April 14 2019 21:26 GMT
#802
On April 15 2019 05:27 SPcrusader wrote:
Show nested quote +
On April 15 2019 00:38 AlgeriaT wrote:
On April 14 2019 22:14 Kevin_Sorbo wrote:
To all the avilo apologists, know that he has a court date scheduled in june for his electronic harassment case...
Seems like even if Twitch doesn't do anything there will be repercussions.

But now they finally did.

www.twitch.tv/avilo

It's over.


Darn it that sucks. I get a feeling there was some major conspiracy behind the scenes to pull this off. If you watch his Tennis Vods you might change your mind about him.


There's no conspiracy dude. Watch his stream, or vods of him being toxic, he's the toxic person. He treats everything the same, always blaming someone or something else for his own shortcomings. Any time something goes wrong there's always someone else to blame and it's never him. Maybe it's time for him to realize that he's the problem.
getg00d
Profile Joined April 2017
United States120 Posts
April 14 2019 21:49 GMT
#803
Did he get 'twitch-banned' again?
https://www.twitch.tv/getg00d
uiotui
Profile Joined February 2010
United States54 Posts
April 14 2019 23:03 GMT
#804
i wish i knew how to paypal to him :[ he is probably in the pain big time :[
WombaT
Profile Blog Joined May 2010
Northern Ireland26622 Posts
Last Edited: 2019-04-15 01:55:39
April 15 2019 01:55 GMT
#805
Why shouldn’t he be banned from Twitch?

And tbh the unconditional fanboy is the problem here, not me.

I would have watched him again, as I did in the past for his particular style and aspects of his play, balance whining and all. Harassing women no, I’m not going to watch until he corrects.

Whereas ‘so what if he does x he’s entertaining’, he never corrects and keeps doing worse and worse things until he’s banned from Twitch, his source of income.

So get salty or moan about conspiracies all you want, you’re part of the problem, way more than I am.

You could have said ‘look avilo I’m a fan but this isn’t cool’, or you could have enabled his worst behaviour until it got to such a degree that Twitch banned him.
'You'll always be the cuddly marsupial of my heart, despite the inherent flaws of your ancestry' - Squat
KadaverBB
Profile Blog Joined June 2009
Germany25658 Posts
April 15 2019 02:16 GMT
#806
Since this no longer fulfills the function of an actual fan club and is more like "Avilo General Discussion" we are going to lock this thread.
AdministratorLaws change depending on who's making them, but justice is justice
Normal
Please log in or register to reply.
Live Events Refresh
Wardi Open
11:00
#83
WardiTV642
OGKoka 253
Rex105
Liquipedia
Afreeca Starleague
10:00
Ro16 Group C
Bisu vs Ample
Jaedong vs Flash
Afreeca ASL 25733
StarCastTV_EN755
Liquipedia
Replay Cast
09:00
SEL Doubles #1
CranKy Ducklings56
Liquipedia
[ Submit Event ]
Live Streams
Refresh
StarCraft 2
Lowko344
OGKoka 253
SortOf 141
Hui .120
Rex 105
StarCraft: Brood War
Calm 15307
Sea 8639
BeSt 3067
ZerO 1585
Mini 1167
EffOrt 1075
firebathero 732
Pusan 489
Soma 478
Stork 391
[ Show more ]
Soulkey 368
actioN 335
Hyun 244
Rush 229
Snow 211
hero 173
Larva 138
ToSsGirL 123
ggaemo 113
Killer 82
Sharp 49
Backho 47
sSak 39
Sea.KH 34
Barracks 29
JulyZerg 27
NaDa 24
Sexy 24
Shine 19
yabsab 18
SilentControl 17
Hm[arnc] 16
Terrorterran 12
GoRush 12
Bale 11
Noble 10
Icarus 4
eros_byul 1
Dota 2
Gorgc2587
League of Legends
Reynor69
Counter-Strike
x6flipin348
edward202
allub101
markeloff0
Other Games
singsing2096
B2W.Neo490
crisheroes253
Mew2King54
ArmadaUGS24
Organizations
Dota 2
PGL Dota 2 - Main Stream6620
PGL Dota 2 - Secondary Stream4561
StarCraft: Brood War
UltimateBattle 404
StarCraft 2
Blizzard YouTube
StarCraft: Brood War
BSLTrovo
sctven
[ Show 14 non-featured ]
StarCraft 2
• StrangeGG 74
• CranKy Ducklings SOOP6
• AfreecaTV YouTube
• intothetv
• Kozan
• IndyKCrew
• LaughNgamezSOOP
• Migwel
• sooper7s
StarCraft: Brood War
• BSLYoutube
• STPLYoutube
• ZZZeroYoutube
League of Legends
• TFBlade1235
Other Games
• WagamamaTV186
Upcoming Events
Monday Night Weeklies
4h
RSL Revival
14h
GSL
20h
Afreeca Starleague
22h
Barracks vs Leta
Royal vs Light
WardiTV Map Contest Tou…
23h
RSL Revival
1d 22h
Replay Cast
2 days
The PondCast
2 days
KCM Race Survival
2 days
WardiTV Map Contest Tou…
2 days
[ Show More ]
CranKy Ducklings
3 days
Escore
3 days
RSL Revival
4 days
WardiTV Map Contest Tou…
4 days
Universe Titan Cup
4 days
Rogue vs Percival
Ladder Legends
5 days
uThermal 2v2 Circuit
5 days
BSL
5 days
Sparkling Tuna Cup
5 days
WardiTV Map Contest Tou…
5 days
Ladder Legends
6 days
BSL
6 days
Replay Cast
6 days
Replay Cast
6 days
Wardi Open
6 days
Liquipedia Results

Completed

Escore Tournament S2: W3
RSL Revival: Season 4
NationLESS Cup

Ongoing

BSL Season 22
ASL Season 21
CSL 2026 SPRING (S20)
IPSL Spring 2026
KCM Race Survival 2026 Season 2
StarCraft2 Community Team League 2026 Spring
WardiTV TLMC #16
Nations Cup 2026
IEM Rio 2026
PGL Bucharest 2026
Stake Ranked Episode 1
BLAST Open Spring 2026
ESL Pro League S23 Finals
ESL Pro League S23 Stage 1&2
PGL Cluj-Napoca 2026
IEM Kraków 2026

Upcoming

Escore Tournament S2: W4
Acropolis #4
BSL 22 Non-Korean Championship
CSLAN 4
Kung Fu Cup 2026 Grand Finals
HSC XXIX
uThermal 2v2 2026 Main Event
2026 GSL S2
RSL Revival: Season 5
2026 GSL S1
XSE Pro League 2026
IEM Cologne Major 2026
Stake Ranked Episode 2
CS Asia Championships 2026
IEM Atlanta 2026
Asian Champions League 2026
PGL Astana 2026
BLAST Rivals Spring 2026
TLPD

1. ByuN
2. TY
3. Dark
4. Solar
5. Stats
6. Nerchio
7. sOs
8. soO
9. INnoVation
10. Elazer
1. Rain
2. Flash
3. EffOrt
4. Last
5. Bisu
6. Soulkey
7. Mini
8. Sharp
Sidebar Settings...

Advertising | Privacy Policy | Terms Of Use | Contact Us

Original banner artwork: Jim Warren
The contents of this webpage are copyright © 2026 TLnet. All Rights Reserved.